ID: 1064867055

View in Genome Browser
Species Human (GRCh38)
Location 10:19892765-19892787
Sequence ATGTTTTGATGTTCTCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064867051_1064867055 13 Left 1064867051 10:19892729-19892751 CCATTCCCGTATTTGATGGTCAC 0: 1
1: 0
2: 1
3: 4
4: 74
Right 1064867055 10:19892765-19892787 ATGTTTTGATGTTCTCTGCTGGG No data
1064867053_1064867055 7 Left 1064867053 10:19892735-19892757 CCGTATTTGATGGTCACTTTCTG 0: 1
1: 0
2: 0
3: 16
4: 231
Right 1064867055 10:19892765-19892787 ATGTTTTGATGTTCTCTGCTGGG No data
1064867049_1064867055 21 Left 1064867049 10:19892721-19892743 CCTGCAAACCATTCCCGTATTTG 0: 1
1: 0
2: 0
3: 10
4: 62
Right 1064867055 10:19892765-19892787 ATGTTTTGATGTTCTCTGCTGGG No data
1064867052_1064867055 8 Left 1064867052 10:19892734-19892756 CCCGTATTTGATGGTCACTTTCT 0: 1
1: 0
2: 0
3: 19
4: 271
Right 1064867055 10:19892765-19892787 ATGTTTTGATGTTCTCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064867055 Original CRISPR ATGTTTTGATGTTCTCTGCT GGG Intronic
No off target data available for this crispr