ID: 1064868107

View in Genome Browser
Species Human (GRCh38)
Location 10:19905101-19905123
Sequence CTGTTTCCCATTAAGATTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064868107_1064868109 -2 Left 1064868107 10:19905101-19905123 CCCTAAATCTTAATGGGAAACAG No data
Right 1064868109 10:19905122-19905144 AGAACCTCGTGTGCTCTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064868107 Original CRISPR CTGTTTCCCATTAAGATTTA GGG (reversed) Intronic
No off target data available for this crispr