ID: 1064873320

View in Genome Browser
Species Human (GRCh38)
Location 10:19964263-19964285
Sequence GATAAAGTTGTAAGCCTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 88}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064873320_1064873326 26 Left 1064873320 10:19964263-19964285 CCTTAGAGGCTTACAACTTTATC 0: 1
1: 0
2: 2
3: 4
4: 88
Right 1064873326 10:19964312-19964334 GGGTAAGCACAACAATAAGAAGG No data
1064873320_1064873322 -10 Left 1064873320 10:19964263-19964285 CCTTAGAGGCTTACAACTTTATC 0: 1
1: 0
2: 2
3: 4
4: 88
Right 1064873322 10:19964276-19964298 CAACTTTATCTTTTGTCGGTTGG No data
1064873320_1064873327 30 Left 1064873320 10:19964263-19964285 CCTTAGAGGCTTACAACTTTATC 0: 1
1: 0
2: 2
3: 4
4: 88
Right 1064873327 10:19964316-19964338 AAGCACAACAATAAGAAGGAAGG No data
1064873320_1064873324 5 Left 1064873320 10:19964263-19964285 CCTTAGAGGCTTACAACTTTATC 0: 1
1: 0
2: 2
3: 4
4: 88
Right 1064873324 10:19964291-19964313 TCGGTTGGTTGGTTTTCAACTGG No data
1064873320_1064873325 6 Left 1064873320 10:19964263-19964285 CCTTAGAGGCTTACAACTTTATC 0: 1
1: 0
2: 2
3: 4
4: 88
Right 1064873325 10:19964292-19964314 CGGTTGGTTGGTTTTCAACTGGG No data
1064873320_1064873323 -6 Left 1064873320 10:19964263-19964285 CCTTAGAGGCTTACAACTTTATC 0: 1
1: 0
2: 2
3: 4
4: 88
Right 1064873323 10:19964280-19964302 TTTATCTTTTGTCGGTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064873320 Original CRISPR GATAAAGTTGTAAGCCTCTA AGG (reversed) Intronic
904809917 1:33156781-33156803 GATGAAGTTGTAAGCCTGTAAGG - Intronic
907622438 1:55995270-55995292 GGTAAAGTAGAAAGCTTCTAAGG - Intergenic
909816299 1:79998799-79998821 GATAGAGCTCTAAGCCTTTATGG - Intergenic
916708742 1:167381397-167381419 TAAAAAGTTCTAAACCTCTATGG + Intronic
922547225 1:226466968-226466990 GATAGAGCTGTAATCCTCGAGGG + Intergenic
923286409 1:232500383-232500405 GATAAAATTGGAAGCCTGGAAGG + Intronic
923621577 1:235583751-235583773 GCTAAAGATGGAAGCCTGTATGG - Exonic
1064873320 10:19964263-19964285 GATAAAGTTGTAAGCCTCTAAGG - Intronic
1065329179 10:24575685-24575707 GATAAAGATGCAAGGCTCTCTGG + Intergenic
1067431920 10:46250886-46250908 GATGAAGTTGTTAGCATTTAGGG - Intergenic
1078950979 11:16133987-16134009 TATACAGTTTTAAGCCACTATGG + Intronic
1085975237 11:81645061-81645083 GATAATGTTACAAGCTTCTATGG - Intergenic
1086036328 11:82419517-82419539 CTTAAAGTTGTAAGAATCTAGGG - Intergenic
1086060315 11:82693504-82693526 GAAAATGTTGTAAGCCCCCAAGG + Intergenic
1087276709 11:96168203-96168225 TATAAAGTTGTAAGGATCAAAGG + Intronic
1087390736 11:97529599-97529621 AAAAAAATTATAAGCCTCTAAGG + Intergenic
1089048210 11:115522464-115522486 GGTAAAGTATTAAGTCTCTAGGG + Intergenic
1092446294 12:8560529-8560551 GATTAAGTTCTAGTCCTCTAGGG + Intergenic
1101396516 12:104353558-104353580 GATAAAATTGTAATACCCTAAGG + Intergenic
1101587570 12:106098471-106098493 GACAAAGTAGGAAGCCTCTTTGG - Intronic
1108950611 13:56087818-56087840 GTTCAAGTTGTAAGCCTTAATGG + Intergenic
1109681466 13:65757745-65757767 GCTAGAGTTGTAAGATTCTATGG - Intergenic
1111599546 13:90454602-90454624 GTTAAATTTGAAAGCATCTAAGG + Intergenic
1112210547 13:97373063-97373085 GGTAAAGTGGCCAGCCTCTATGG + Intronic
1116045954 14:39742472-39742494 TATAAATTAGTAAGCCACTATGG - Intergenic
1121683722 14:95816199-95816221 GATAGACTTGGAAGCCTCTTTGG + Intergenic
1124903626 15:33847634-33847656 GATATAGTGGTATGGCTCTAAGG - Intronic
1126362743 15:47863092-47863114 GATAAAGTTGTAAACCTCTGGGG + Intergenic
1127023354 15:54775753-54775775 GATAAAGTTATAAGGTTATAAGG - Intergenic
1155066722 18:22274539-22274561 GAGAAAGTTCCAAGCCTTTAGGG + Intergenic
1155075883 18:22354623-22354645 TATAAATTAGTAAACCTCTAAGG - Intergenic
1156523031 18:37737956-37737978 GATAAAGATGAAAGCCTTTGTGG + Intergenic
1156554191 18:38048661-38048683 GATAAACTTGTTAACCTCTCTGG - Intergenic
926732505 2:16047307-16047329 GAAAAAATTTAAAGCCTCTATGG - Intergenic
928841233 2:35607457-35607479 GCTGAAGTTGTAAACATCTAAGG - Intergenic
931994873 2:67830258-67830280 CTCAAAGTTGTAAACCTCTAGGG + Intergenic
932391266 2:71392812-71392834 GATAAGGTTCTAGTCCTCTAAGG - Intronic
934913981 2:98283419-98283441 CATAAAGTTTAAAGCCTTTACGG - Intronic
942822736 2:180135243-180135265 GATAAAGGTGTGAGCTTCTCAGG + Intergenic
946050309 2:216856678-216856700 GATAAAGTGGCAAACTTCTAAGG + Intergenic
947222214 2:227804464-227804486 CATTATGTTGCAAGCCTCTATGG - Intergenic
1170412121 20:16103167-16103189 GCTAAAGCTGAAAGCCTCTTTGG + Intergenic
1177409949 21:20717246-20717268 TTTAAAGTTGTAACCCTCAATGG + Intergenic
949566138 3:5246527-5246549 GAGGCAGTTGTTAGCCTCTATGG + Intergenic
949673859 3:6430055-6430077 GATAAAATTATTAACCTCTATGG + Intergenic
955594049 3:60569371-60569393 GATAAAGGAGTTAGCCTCTTTGG - Intronic
956147440 3:66205316-66205338 GAGAAAGATGTAAGACTCTGGGG - Intronic
957883504 3:86253401-86253423 GATGATGTTGTAAACCTCCAAGG - Intergenic
961935138 3:130574939-130574961 AATAAAGATATAAACCTCTAGGG - Intronic
964950688 3:162288645-162288667 GTTAAAGTTATAAAACTCTATGG + Intergenic
974550733 4:63369694-63369716 GTAAAAGTTGTAAGACTCTTAGG - Intergenic
978691368 4:111515503-111515525 GATAAAGATTTCTGCCTCTATGG + Intergenic
979082936 4:116365556-116365578 AATAAAATTGTAAGTCTCTTAGG + Intergenic
980526191 4:133993573-133993595 GATTAAGTTCTAGTCCTCTAGGG + Intergenic
980628924 4:135409168-135409190 GATTAGGTTCTAATCCTCTAGGG - Intergenic
982388409 4:154837677-154837699 GATCAGGTTCTAATCCTCTAGGG + Intergenic
986146504 5:5082896-5082918 GAAAAAGTTCTAAGTCTCTCTGG - Intergenic
989028318 5:37091159-37091181 GATGAGGTTCTAATCCTCTAGGG - Intergenic
989644115 5:43610705-43610727 GATAAAGTTGGAGGCTTGTAGGG - Intronic
992641982 5:78775542-78775564 AATTAGGTTGTAAGCCTCTTAGG + Intergenic
993604518 5:89972180-89972202 AATACAGTTGTAAAACTCTATGG + Intergenic
995364799 5:111346464-111346486 GATAAAGTTTCAAGCCTCTTGGG - Intronic
998721036 5:144949434-144949456 GGTAAATTGGTAAACCTCTATGG + Intergenic
999962355 5:156769514-156769536 GATGAAGCTGTAAGACTCTCTGG + Intergenic
1005576060 6:27190593-27190615 GATTAGGTTCTAATCCTCTAGGG - Intergenic
1006281078 6:33053944-33053966 GATTAGGTTCTAATCCTCTAGGG - Intergenic
1006281392 6:33056617-33056639 GATTAGGTTCTAATCCTCTAGGG + Intergenic
1007290635 6:40783544-40783566 GATAAATGTCTCAGCCTCTATGG + Intergenic
1008996631 6:57667361-57667383 GATAAAATTGGAAGTTTCTACGG + Intergenic
1022788264 7:33660548-33660570 AATAACGTTTTAAGCCTCTTTGG + Intergenic
1023575070 7:41618578-41618600 AATAAAGTGGGAAGCCTCTGAGG + Intergenic
1024439846 7:49404349-49404371 GATACAGTTGGAAGCAACTAAGG + Intergenic
1025216813 7:57062785-57062807 GATACAGTTGAAAGCATGTAAGG - Intergenic
1025654571 7:63507962-63507984 GATACAGTTGAAAGCATGTAAGG + Intergenic
1026414243 7:70161705-70161727 AAGTAAGTTGTCAGCCTCTAAGG - Intronic
1027833187 7:83206819-83206841 GTTAAATTTGGAAGCCTCTATGG + Intergenic
1031939885 7:127777383-127777405 GATAAAGTTGTTAGACATTAGGG + Intronic
1038653404 8:29426540-29426562 GAGCAAGTTTTAATCCTCTAGGG - Intergenic
1045886555 8:107105358-107105380 GATAAAGTTGTATGGCTATCAGG + Intergenic
1048411280 8:134176134-134176156 TGTAAATTTGTAAGCCTCTTTGG - Intergenic
1051170891 9:14316568-14316590 GATAAAGTTGGCAGTCTTTATGG + Intronic
1059856252 9:118400809-118400831 AATAAAGTTGTAAGTCTATCTGG - Intergenic
1186620244 X:11232900-11232922 GATAAAGTTTTTACACTCTAGGG - Intronic
1187275236 X:17811034-17811056 GGTAAAGGAGTAAGTCTCTAAGG + Intronic
1188254100 X:27938457-27938479 GATAAAATTGCATACCTCTAAGG - Intergenic
1188347941 X:29090871-29090893 GAGAAAGTTCTCAGCCTCTATGG - Intronic
1190117331 X:47634933-47634955 GCTAAAGCTGTAAGACTGTATGG - Intergenic
1191011252 X:55761806-55761828 GATTAGGATGTAATCCTCTATGG - Intergenic
1193939608 X:87665080-87665102 GATCAACTTGTAATTCTCTAAGG - Intronic
1195397118 X:104423238-104423260 TTCAAAGTTGTAAGACTCTAGGG + Intergenic
1197289108 X:124632954-124632976 GATAAAGTAGAAAGGCTCTGTGG - Intronic
1198362800 X:135912588-135912610 GATAAATTTGGAAGCCTCCATGG - Intronic
1198668940 X:139056869-139056891 AAAAAAGTTGTAAGTTTCTAGGG - Intronic
1199064261 X:143395804-143395826 GATAAAGTGGCCAGCCTCCAGGG - Intergenic
1201241547 Y:11961740-11961762 GAGAATTTTGTAAGCATCTAAGG - Intergenic