ID: 1064873327

View in Genome Browser
Species Human (GRCh38)
Location 10:19964316-19964338
Sequence AAGCACAACAATAAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064873320_1064873327 30 Left 1064873320 10:19964263-19964285 CCTTAGAGGCTTACAACTTTATC 0: 1
1: 0
2: 2
3: 4
4: 88
Right 1064873327 10:19964316-19964338 AAGCACAACAATAAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064873327 Original CRISPR AAGCACAACAATAAGAAGGA AGG Intronic
No off target data available for this crispr