ID: 1064874194

View in Genome Browser
Species Human (GRCh38)
Location 10:19974725-19974747
Sequence TAGGTTCTCCATGGGTATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064874194 Original CRISPR TAGGTTCTCCATGGGTATAG TGG (reversed) Intronic
902260757 1:15223133-15223155 TTGGTTCTCCCTGGGTATCCCGG - Intergenic
906350766 1:45056972-45056994 TAGGTTCTCCATAGGTGTATAGG + Intronic
913309355 1:117472494-117472516 TAAGTTCTCCAAGGGTATTAGGG - Intronic
914423715 1:147554744-147554766 TAGTTTCTACATGGGTAAAATGG + Intronic
914676440 1:149910332-149910354 TAAGTCATCCATGGGTAAAGAGG + Intronic
915886563 1:159728515-159728537 TAGCTTGGCCATGGGTATATAGG - Intergenic
918912794 1:190595324-190595346 TAGGTTCCCAATGGGGAAAGAGG + Intergenic
920496575 1:206459128-206459150 TAGGTTCTTCCTGGGGAGAGAGG - Intronic
1064874194 10:19974725-19974747 TAGGTTCTCCATGGGTATAGTGG - Intronic
1066249734 10:33621319-33621341 TACATTCTCCATAGATATAGAGG + Intergenic
1075318320 10:121469577-121469599 CAGGTTCTCCCTGGGTCTACAGG + Intergenic
1081703039 11:45163932-45163954 CAGGTTCTCCATGGGGTGAGGGG - Intronic
1083159461 11:60845875-60845897 TTGGTTCTACCTGGGTATTGAGG - Intronic
1086941332 11:92801367-92801389 TACTTTGTCCAGGGGTATAGTGG - Exonic
1087269111 11:96092945-96092967 TATTTTCTCCATGGGTAAGGAGG + Exonic
1087628082 11:100620186-100620208 TACTTTCCCCATGTGTATAGAGG + Intergenic
1087940320 11:104088845-104088867 TAGAACCTCCCTGGGTATAGAGG - Intronic
1089157563 11:116414065-116414087 TAGGTTCTCCTTGGGTAGGCTGG - Intergenic
1092500316 12:9039044-9039066 TAAGTTGTCCAAGGGTATGGAGG + Intergenic
1094677998 12:32640141-32640163 TGAGTTCTCCATGGGCACAGAGG - Intronic
1096937090 12:55292748-55292770 TAGTTTCTCCATATGTAAAGTGG - Intergenic
1103230971 12:119330177-119330199 TAGAGTTTCCATGGGCATAGAGG - Intergenic
1108051842 13:46452146-46452168 GTGTTTCTCCATGGGTATATAGG + Intergenic
1110346951 13:74459646-74459668 CAGTTTCTCCATGTGTATAGAGG + Intergenic
1114644631 14:24248232-24248254 TAGGTTCTGCATGGTAGTAGAGG - Intergenic
1115786577 14:36833338-36833360 AAGGTGCTCCCTGGGTAGAGGGG + Intronic
1120486101 14:85114755-85114777 TAGTTCCTTCATGGGTAAAGTGG + Intergenic
1126190008 15:45869255-45869277 TAGTTTCTCCTTGGGTAAAGAGG + Intergenic
1126884027 15:53130467-53130489 TAGGTTTTCCATCTGTAAAGTGG + Intergenic
1133600641 16:7337104-7337126 TAGGTTCTCCATAGGCAAAGGGG - Intronic
1135463865 16:22668728-22668750 TAGGCTCACACTGGGTATAGTGG - Intergenic
1138894375 16:61185198-61185220 TATATTCTCCGTAGGTATAGTGG - Intergenic
1144690461 17:17259051-17259073 TAGCTTCTCCATTGGGCTAGGGG + Intronic
1149695252 17:58611453-58611475 TAGGTTCTCCATCTGTAAAATGG - Intronic
1150623115 17:66823116-66823138 TTGGTTCTCCAGGGGCATGGAGG - Intergenic
1153350705 18:4078082-4078104 CAGATACTCCATGGGTAAAGGGG + Intronic
1157863587 18:51162274-51162296 TAGTTTCTCCATGTGTAAAATGG + Intergenic
1166782096 19:45348240-45348262 TAGGTGCTCCATGGTGACAGAGG - Intronic
926638819 2:15212982-15213004 TATGTTCTCCACTGGTGTAGAGG + Intronic
927077947 2:19598815-19598837 TAGTTTCTCCATTGGTAAAATGG + Intergenic
932385671 2:71330906-71330928 AAGGTTTTCCATGGGTAAAATGG + Intronic
935942490 2:108255381-108255403 TGTGTTCTCCATGGGTATGAGGG + Intronic
941249786 2:163147784-163147806 TAGGGTGTCCATGGGTAGAGTGG + Intergenic
948555282 2:238805934-238805956 CAGGTTCTCCATTTGTCTAGTGG + Intergenic
1171103331 20:22407580-22407602 TAGTTTCTCCATCTGTAAAGTGG - Intergenic
1172436869 20:34935053-34935075 TAGTTTCTCCATCTGTATAATGG + Intronic
1176063815 20:63183847-63183869 CAGGACCTCCATGGGTAGAGAGG + Intergenic
951928607 3:27938143-27938165 TAGGTTTTCACTGGGTATATAGG - Intergenic
961183359 3:124893742-124893764 TAGGTTCAGCATGTGCATAGTGG + Intronic
964257334 3:154791112-154791134 CAGGATTTCCATGGATATAGAGG - Intergenic
965227165 3:166004738-166004760 TAGATTCTCAATGTGAATAGTGG - Intergenic
967235353 3:187378669-187378691 TAGACTCACCATGGGTATACTGG - Intergenic
978551756 4:109935023-109935045 TAGGATTTTCTTGGGTATAGGGG + Intronic
979443671 4:120783998-120784020 TAGGAACTTCATGTGTATAGAGG + Intronic
981087112 4:140695626-140695648 TATGATCTCCATGGGAATATGGG - Intronic
987255942 5:16150912-16150934 TAGGATCTGAATGGGTGTAGAGG - Intronic
988124530 5:27012080-27012102 TTGGTTATCTAAGGGTATAGTGG - Intronic
993475132 5:88355375-88355397 TAAGGTCTCCATATGTATAGTGG + Intergenic
998116718 5:139543441-139543463 CAGGATCTACGTGGGTATAGAGG - Intronic
998254709 5:140575757-140575779 TACATTCTCCATGGGCATGGTGG + Intronic
1001308212 5:170591063-170591085 TAGATGCTCCATGGGCATGGTGG - Intronic
1001849682 5:174952473-174952495 TGGGTTCTCCAAGTGTAGAGGGG - Intergenic
1003860656 6:10319350-10319372 AGGGTTTTCCATGGGGATAGAGG + Intergenic
1003860665 6:10319381-10319403 CAGGTTTTCCGTGGGGATAGAGG + Intergenic
1008001291 6:46362829-46362851 TGGGTTTTCCATGGGTATGCAGG - Intronic
1011712267 6:90066771-90066793 GTGCTTCTCCATGAGTATAGTGG - Intronic
1012995446 6:105968165-105968187 TACTTTCTCCATGGAAATAGGGG - Intergenic
1013737313 6:113242658-113242680 TAGAATATCCAGGGGTATAGGGG + Intergenic
1014804328 6:125812266-125812288 TAGGATTTCAATGGGTAAAGTGG - Intronic
1016353632 6:143194697-143194719 CAGGTTCTCCAGGGGTACTGGGG - Intronic
1017145393 6:151230021-151230043 CAGTTTCTCCAAGGGTCTAGGGG + Intergenic
1019083991 6:169457039-169457061 TAGGTTCTGCATGGTTAGTGTGG - Intergenic
1019413252 7:915785-915807 TAGGTTCTGCAGGGGTATATGGG - Intronic
1021795934 7:24254298-24254320 TGGGTTCTCCATGGGAGAAGGGG - Intergenic
1028650970 7:93150530-93150552 AGGGTTCTCCAAGGGGATAGAGG - Intergenic
1032475070 7:132206135-132206157 TAGTTTCCCCATTGGTAAAGTGG + Intronic
1033634930 7:143203583-143203605 TAGGGTCTCCATGGTGATACAGG - Intergenic
1038311930 8:26451399-26451421 CAGTTTCTCCATGGGTAAATTGG + Intronic
1041112613 8:54499693-54499715 TGTGTTCTCCATGGATAAAGAGG + Intergenic
1041464640 8:58146226-58146248 TAGGGTCTCCGTGGGCATGGTGG - Exonic
1054712641 9:68526476-68526498 TAGGATATCTATGTGTATAGTGG - Intronic
1056468977 9:86886746-86886768 TTGGTTCTCCCTGGGTCTTGTGG + Intergenic
1057560216 9:96122307-96122329 TAGGATCTTCAGGGGTAAAGAGG - Intergenic
1186627074 X:11305858-11305880 TATATTCTCCATGGCTGTAGGGG - Intronic
1189157942 X:38778777-38778799 TATGTTCTCGATTGGGATAGTGG - Intergenic
1193009121 X:76656370-76656392 TTTGGTCTCCATGGCTATAGTGG - Intergenic
1193481674 X:82035385-82035407 TAGGTCATACATGGGTAGAGGGG + Intergenic
1194400745 X:93435771-93435793 TAGGTTTTCCATGGCTGTGGTGG - Intergenic
1195066480 X:101242555-101242577 TAGGATCTGCATGGGAAAAGAGG + Intronic