ID: 1064880569

View in Genome Browser
Species Human (GRCh38)
Location 10:20048376-20048398
Sequence GAATATAGAAAAAACTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 382}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064880569_1064880574 -10 Left 1064880569 10:20048376-20048398 CCACCCCAGTTTTTTCTATATTC 0: 1
1: 0
2: 1
3: 27
4: 382
Right 1064880574 10:20048389-20048411 TTCTATATTCAGGCAACCCCAGG No data
1064880569_1064880579 27 Left 1064880569 10:20048376-20048398 CCACCCCAGTTTTTTCTATATTC 0: 1
1: 0
2: 1
3: 27
4: 382
Right 1064880579 10:20048426-20048448 GATTTAGAAATAATTCACAGTGG No data
1064880569_1064880575 -6 Left 1064880569 10:20048376-20048398 CCACCCCAGTTTTTTCTATATTC 0: 1
1: 0
2: 1
3: 27
4: 382
Right 1064880575 10:20048393-20048415 ATATTCAGGCAACCCCAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064880569 Original CRISPR GAATATAGAAAAAACTGGGG TGG (reversed) Intronic
900651859 1:3733719-3733741 GAAATTGGAGAAAACTGGGGAGG + Exonic
901141160 1:7032486-7032508 GAATTTAAAAAAAGATGGGGAGG - Intronic
903772997 1:25775845-25775867 CAAAACAAAAAAAACTGGGGTGG - Intronic
904246533 1:29192110-29192132 CAATATGGAAAAAACTGGCTCGG - Intergenic
905553754 1:38865505-38865527 GAAAAAAGAAAAAACTGGCTGGG + Intronic
907582736 1:55586580-55586602 GAAAATAGAAACAACTGGAGTGG - Intergenic
908297431 1:62727051-62727073 GAATAGAGAAAACAGAGGGGAGG - Intergenic
908846020 1:68325122-68325144 TAAAATAAAATAAACTGGGGGGG - Intergenic
909124045 1:71642427-71642449 GGAGAGAGAAAAAATTGGGGGGG + Intronic
909230037 1:73076654-73076676 GAATTTATAAATAAATGGGGAGG + Intergenic
909963707 1:81880973-81880995 AAATATAGGAAGAAATGGGGTGG - Intronic
911590901 1:99746494-99746516 GAATATGGAAAAAAAAGGTGGGG + Intronic
912187000 1:107289531-107289553 AAGTATAGAAAACCCTGGGGTGG - Intronic
912188561 1:107310696-107310718 GAAAATAGAAAATCTTGGGGGGG + Intronic
912413257 1:109491961-109491983 GATTATAGCAAAAGCAGGGGTGG - Intronic
912793699 1:112676541-112676563 GAATACAGCAAAAACAGCGGGGG + Intronic
912838917 1:113021593-113021615 GAACAGAGAAAAAGCTGAGGTGG - Intergenic
913708767 1:121456996-121457018 GAATATTGTGAAAACTGGGTAGG + Intergenic
915816047 1:158966327-158966349 AACTATTCAAAAAACTGGGGAGG + Intronic
916096194 1:161352990-161353012 GAAAAAAGAAAAAATTGGTGTGG + Intronic
916841750 1:168608504-168608526 TAATCTAGGGAAAACTGGGGTGG + Intergenic
916988351 1:170215435-170215457 GAATCTAGAAAAAGCTTGGAAGG - Intergenic
917389154 1:174514257-174514279 AAAAAAAAAAAAAACTGGGGAGG + Intronic
917581356 1:176381378-176381400 GAATACAGAAAAGACTGAGAAGG + Intergenic
918120878 1:181539167-181539189 GAAAATAGAAGGAAATGGGGAGG - Intronic
919127777 1:193417001-193417023 GCAAATAGAAAAAAAAGGGGGGG - Intergenic
919527981 1:198678825-198678847 TAAAGAAGAAAAAACTGGGGGGG - Intronic
919747844 1:201019846-201019868 GAAGACAGAAGAAACTGTGGGGG - Intronic
920527175 1:206675636-206675658 GGATACACAAGAAACTGGGGTGG + Intronic
920807950 1:209252766-209252788 GAAGAGAGAAAAAAATGGGTAGG + Intergenic
921856285 1:219988754-219988776 GTATAAAGAAAAAACTGGGAAGG - Exonic
922958895 1:229627850-229627872 AAATAGAGAAAAAGTTGGGGAGG + Intronic
924719669 1:246610305-246610327 AAATATAAAAAAGAATGGGGAGG - Intronic
1063578345 10:7282003-7282025 AAAAATAGAAAAAACTGGCTAGG - Intronic
1064607136 10:17054334-17054356 AAAAAAAAAAAAAACTGGGGAGG + Intronic
1064857688 10:19789305-19789327 GAGAAGAAAAAAAACTGGGGGGG - Intronic
1064860358 10:19818142-19818164 GAAAAAAGAAAAAACTTGGAGGG + Intronic
1064880569 10:20048376-20048398 GAATATAGAAAAAACTGGGGTGG - Intronic
1065163093 10:22944024-22944046 AAATATAAAAACAACTGTGGTGG - Intronic
1065295720 10:24272911-24272933 GACCAGAGAAAGAACTGGGGTGG - Intronic
1067734559 10:48839170-48839192 GAAAATAGAAAGAACTGGTTTGG + Intronic
1067916432 10:50404446-50404468 GAAAATACAAAAAACTAGGTGGG + Intronic
1070759872 10:79017433-79017455 AAAAATAGAAAAAAATTGGGCGG - Intergenic
1071568331 10:86682942-86682964 GATTCTAGAAAGAGCTGGGGGGG - Intronic
1072040247 10:91600204-91600226 TAATAAAGAAAAACCTGGGGAGG - Intergenic
1072109329 10:92303142-92303164 GTATGTAGAAAAAAGTGAGGGGG - Intronic
1072641546 10:97214832-97214854 GAATATAGAACCATCTGGTGTGG - Intronic
1073749166 10:106504538-106504560 GAATATATATAATACTGGTGTGG - Intergenic
1075073901 10:119337610-119337632 AAAAAGAGAAAAAAGTGGGGGGG - Intronic
1080148146 11:29014554-29014576 TAATATAGAATAAATTGGGCTGG - Intergenic
1080496069 11:32820490-32820512 GAATATAGAAATAGCTGAAGAGG + Intergenic
1081715291 11:45245878-45245900 GAAGAGAGAAGAGACTGGGGTGG + Intronic
1081882773 11:46468227-46468249 TAATACAAAAAAAAGTGGGGAGG + Intronic
1082926066 11:58548948-58548970 ATATATTGAAAAAACAGGGGAGG + Intronic
1085485975 11:76862927-76862949 GAACCAAGAAAAAACTGGGCTGG + Intronic
1085881626 11:80473976-80473998 GAATATAGAAAAATCTCCTGGGG - Intergenic
1086238564 11:84661775-84661797 GAATATAGAAATAACTTGGCAGG + Intronic
1090321805 11:125851441-125851463 GAATATAGAAAAAAATAATGTGG - Intergenic
1090623019 11:128578236-128578258 GAATAAAGGAAAAATTAGGGAGG + Intronic
1091157380 11:133386197-133386219 AAAGAAAGAAAAAACTGGGTTGG - Intronic
1091912654 12:4244428-4244450 GAAGTTAGAAAAGACTGGGAAGG + Intergenic
1092341151 12:7677212-7677234 GGAAATAGAAAAAGCTGGAGTGG + Intergenic
1092553598 12:9530990-9531012 AAATAAAAAAAAAAGTGGGGGGG - Intergenic
1093173906 12:15889529-15889551 GAATAGAGAAAAAATTGGCATGG + Intronic
1093250240 12:16793876-16793898 GAATATGGAGAATACTGGGCAGG + Intergenic
1094012224 12:25821384-25821406 GAATATACAAGAGACTGAGGAGG + Intergenic
1094518500 12:31159633-31159655 AAATAAAAAAAAAAGTGGGGGGG + Intergenic
1094603062 12:31927217-31927239 GAAAATACAAAAAATTGGCGGGG - Intergenic
1096011189 12:48216802-48216824 GAAGGCAGAAAAAACTGGGAGGG + Intergenic
1096302927 12:50447860-50447882 AAAAATAGAAAAAAATGGGGGGG - Intronic
1096842436 12:54387923-54387945 GAATATAGGAATGGCTGGGGAGG + Intronic
1099163691 12:79275531-79275553 GAATATAAAAAATCCTGGGATGG + Intronic
1100210588 12:92394688-92394710 GAATATAGAATAATCATGGGTGG + Intergenic
1100421983 12:94443781-94443803 GAATATAGAATAAATTAGGCCGG - Intronic
1100511293 12:95276989-95277011 GGATATAGAAAAAAGTGGATGGG - Intronic
1100761378 12:97811191-97811213 GAATATAGCAAAAAGTGGGGAGG - Intergenic
1101196340 12:102386654-102386676 GCATATAGATTAGACTGGGGTGG + Intergenic
1102374908 12:112414374-112414396 GAATATAGGAAACACTAGGAAGG + Intronic
1102486103 12:113258474-113258496 GAAGAAAGAAAAAACAAGGGTGG + Intronic
1102777595 12:115534008-115534030 AAATAAAGAAAAAAGTGGTGAGG + Intergenic
1104992010 12:132630588-132630610 AAAAATACAAAAAATTGGGGGGG + Intronic
1106190600 13:27449450-27449472 GCATAAAGAAGAAACTGGAGAGG - Intronic
1106459042 13:29952339-29952361 TAATAGAGAAAAAACTTGGAGGG - Intergenic
1107609168 13:42095588-42095610 GAATATAGAAGAAAATTGGGAGG - Intronic
1107957711 13:45532714-45532736 AAATATAAAAAAAATTGGCGGGG - Intronic
1108112032 13:47083796-47083818 GAACATAGAATCAACTGGGCCGG + Intergenic
1110317107 13:74121981-74122003 GATTAAAGACAAAAATGGGGGGG + Intronic
1110344912 13:74434725-74434747 CAAGATAGAAATAACTTGGGAGG - Intergenic
1110870367 13:80445401-80445423 GAAAAAAGCAAAAATTGGGGGGG - Intergenic
1111027130 13:82542775-82542797 AAATAGAGAAAAAATTTGGGTGG + Intergenic
1111955936 13:94758505-94758527 AAAGATAGAACAGACTGGGGAGG - Intergenic
1113243717 13:108369938-108369960 GAATAAAGAAAAAAAAGGGGGGG + Intergenic
1113293857 13:108936260-108936282 AACTATAGAAAAAATTGGTGAGG - Intronic
1113543037 13:111123622-111123644 GAATAGAGAAAATACTAGAGAGG - Intronic
1114699139 14:24659630-24659652 TAATAAAGAAAAAACTGGCATGG - Intergenic
1116331924 14:43608081-43608103 GATTCTAGAAAAAAGTGGAGGGG - Intergenic
1116574624 14:46557339-46557361 GACTGTAGAAAATACTGGGTAGG + Intergenic
1116696668 14:48187065-48187087 GAATTTAGAAAAAACATTGGAGG + Intergenic
1116852432 14:49921890-49921912 AAATATAAAAACAACTGGAGTGG + Intergenic
1117296648 14:54386606-54386628 GAAAAAACAAAACACTGGGGAGG + Intergenic
1117555080 14:56875840-56875862 GAAAATAGGAAAAACTAGGGTGG - Intergenic
1118043990 14:61946834-61946856 GATTACAGAAAAAATTGGGGAGG + Intergenic
1118078931 14:62335806-62335828 AAAAAAAAAAAAAACTGGGGCGG + Intergenic
1118444223 14:65837275-65837297 GAATCTGGAAAGAACTGGGATGG + Intergenic
1119258312 14:73219328-73219350 GACTATAACAAAATCTGGGGAGG + Exonic
1122435401 14:101692075-101692097 TAATAAAGCAAAAAGTGGGGAGG + Intergenic
1122490312 14:102110875-102110897 GAAAATACAAAAAATTGGGCTGG - Intronic
1123759567 15:23422043-23422065 GGATAAAAAAATAACTGGGGTGG - Intergenic
1124174121 15:27406204-27406226 GAACATATAAATAAATGGGGAGG + Intronic
1125247282 15:37654924-37654946 GAATATAGGAGAAACTTGGTGGG - Intergenic
1125382393 15:39100707-39100729 GAAGAAAGAAACAACTGGAGAGG - Intergenic
1125653597 15:41337902-41337924 GAAAAGAAAAAAAAATGGGGTGG - Intronic
1126924043 15:53562319-53562341 GAATTAAGAAATAATTGGGGTGG - Intronic
1128431230 15:67596448-67596470 GTATATAGAAAAAAAAGGGAGGG + Intronic
1128867258 15:71123690-71123712 GAATTCAGAAAGACCTGGGGTGG + Intronic
1129571464 15:76689546-76689568 GAATATAGAAGAAACTGATATGG + Intronic
1129583950 15:76842909-76842931 GTATATAGAAAGAAATGAGGTGG - Intronic
1130520998 15:84660495-84660517 TACTATAGAAAAAAAAGGGGGGG + Intergenic
1131398462 15:92105522-92105544 GAAGATGGAAACAACTTGGGCGG - Intronic
1131717652 15:95130798-95130820 GAAGATTGAAAAAGCAGGGGTGG + Intergenic
1132048668 15:98588357-98588379 GAAAATAGAAAAAATTGAGGTGG + Intergenic
1132084028 15:98891834-98891856 AAATATAAAACAAACTGGTGAGG - Intronic
1132489063 16:215322-215344 GAAAATACAAAAAATTGGGCCGG + Intronic
1132795049 16:1716247-1716269 GAATACTGAAAAAACTGGCTTGG + Intronic
1133804548 16:9114743-9114765 GAATATAGATTACACTTGGGTGG + Intronic
1134456780 16:14400852-14400874 GGATAAAAAAATAACTGGGGCGG + Intergenic
1134774171 16:16837582-16837604 GAATTTTGAAAACACTGCGGTGG + Intergenic
1135611060 16:23867500-23867522 GAAATTATAAAAAAGTGGGGAGG - Intronic
1138156211 16:54705778-54705800 GAATATAGGAAGAATGGGGGAGG + Intergenic
1139018511 16:62719609-62719631 GCTTTTAGAAAAAACTGTGGGGG + Intergenic
1139789602 16:69423058-69423080 GAAAATAGAAGAAACTGAAGAGG + Intergenic
1143045048 17:4071506-4071528 GATTATAAAAAAAACTTGGTAGG + Intronic
1145391057 17:22455790-22455812 TAATAACAAAAAAACTGGGGTGG + Intergenic
1146112173 17:30099923-30099945 GAATACAGAAAAAAGAGGGCAGG - Intronic
1146532033 17:33616168-33616190 GCATAGATGAAAAACTGGGGTGG - Intronic
1146712342 17:35053379-35053401 AAATCTAGAAAAAACAGGGAGGG + Intronic
1146803425 17:35845413-35845435 GAAAATAAAAAAAATTGGCGAGG - Intronic
1148181767 17:45610949-45610971 AAAAATACAAAAAACTGGGCTGG - Intergenic
1148599890 17:48886289-48886311 GATTATAGAAATAAATTGGGAGG + Intergenic
1149808796 17:59646179-59646201 GAATATATACATAAGTGGGGTGG - Intronic
1150090178 17:62317061-62317083 GAATATATAAGAATCTGGGCCGG + Intergenic
1150519277 17:65849418-65849440 GGGTATATAAAAAACAGGGGAGG - Intronic
1150522538 17:65884150-65884172 GAATACAGAAAAAAAAGTGGGGG + Intronic
1152226421 17:79094872-79094894 GAATGTGGTAAATACTGGGGAGG + Intronic
1155081990 18:22419500-22419522 GAATATATAAAGAACTAGGCTGG + Intergenic
1155904877 18:31438193-31438215 GAACATAGAAAAAACTGTGAAGG - Intergenic
1156956033 18:42964533-42964555 TAACATAGACAAAACTGGGCAGG - Intronic
1157247172 18:46064846-46064868 TATTATAGAAAACACTGGGCCGG + Intronic
1158772111 18:60531713-60531735 GAAAAAAAAAAAAAGTGGGGAGG - Intergenic
1161971412 19:7583115-7583137 GAATATAGAAAAAAGTAAGCTGG - Intergenic
1162894446 19:13756813-13756835 GAAAATAGAAAAAATTAGGCTGG + Intronic
1164990380 19:32678271-32678293 CAAAAAAGAAAAAAGTGGGGGGG - Exonic
1165663567 19:37605162-37605184 GTATATATAAGAAACTGGGCTGG + Intronic
1166724395 19:45017330-45017352 TAAAAAAGAAAAATCTGGGGAGG + Intronic
1167581636 19:50347436-50347458 CAATATAGAACAATATGGGGGGG + Intronic
1167926414 19:52824666-52824688 AAATAAAGAAAAATCTGGAGAGG + Intronic
1167926995 19:52829367-52829389 AAATAAAGAAAAAAATAGGGGGG - Intronic
926041632 2:9678247-9678269 TAATATACAACAAACTGGGGGGG - Intergenic
926400012 2:12487545-12487567 GAAAATAAAAAGAAATGGGGTGG + Intergenic
926893018 2:17654621-17654643 GGATATAGAAGAATTTGGGGTGG - Intronic
927324008 2:21782027-21782049 GAACATGGAAAAGACTGGGATGG + Intergenic
927593257 2:24374989-24375011 GGATATAGAAAAAAATTGGCCGG - Intergenic
928341267 2:30445195-30445217 AATTATTTAAAAAACTGGGGGGG + Intergenic
928792772 2:34978509-34978531 AAATGTAGAAAAAACAGGAGTGG + Intergenic
929109207 2:38392264-38392286 GAATATTGAAAAAACCGGCCAGG - Intergenic
929186261 2:39098591-39098613 GAATATATAAAAAATTTGGCCGG + Intronic
929332480 2:40700368-40700390 GAGTATAGAATGAGCTGGGGTGG + Intergenic
933522269 2:83389068-83389090 CATTAAAGAAAAAACTAGGGAGG + Intergenic
935176591 2:100654421-100654443 AAATATAAAAAAAAAAGGGGGGG - Intergenic
936346091 2:111676368-111676390 GAATAAAAATAAAACAGGGGAGG + Intergenic
936699203 2:114989661-114989683 GAACATAGAAGAAACTGGACTGG + Intronic
937443755 2:121938830-121938852 GAACAGAGAATAAACTGGGTTGG + Intergenic
939288131 2:140158860-140158882 GAATATAGAAAAATGTGGGAAGG + Intergenic
940479782 2:154213374-154213396 CAATATAAAGAAAACTGGGCTGG - Intronic
941190945 2:162380971-162380993 AAATATAGACAAAAATGAGGGGG - Intronic
941579653 2:167279100-167279122 GAACAGAGAACAAAGTGGGGTGG + Intergenic
941827243 2:169913751-169913773 GAATTTATAATAAATTGGGGGGG + Intronic
942876389 2:180804809-180804831 GAAGAAAGAACAAAGTGGGGTGG + Intergenic
943341914 2:186692408-186692430 GCATATTGAAAACACTGGGAGGG + Intergenic
944134580 2:196384689-196384711 GAATGTAAAAAATACTAGGGAGG - Intronic
946295546 2:218781091-218781113 GAAAGGAGAAAAAAATGGGGAGG + Intergenic
947075743 2:226343004-226343026 GATTATAGAGAAAACTGATGTGG + Intergenic
947128360 2:226895455-226895477 GAATATAGAAGATACAGGGTAGG + Intronic
947931071 2:233965545-233965567 GAAAATGGAAAAAACTGAGCAGG - Intronic
948621426 2:239237310-239237332 GAATATAGAAAAATCCCAGGCGG - Intronic
1170562165 20:17567902-17567924 GATTATAGAAGGAACTAGGGGGG + Intronic
1171983854 20:31645723-31645745 AAAAATAGAAAAAACTAGGCTGG - Intergenic
1172819817 20:37721918-37721940 GAATACAGAGCAAACTGGTGAGG - Intronic
1173979139 20:47209251-47209273 GAAATCTGAAAAAACTGGGGGGG + Intronic
1174996187 20:55571236-55571258 AAATATAAAAAGAACTGGGATGG - Intergenic
1175097760 20:56555279-56555301 GAATAAGAAAAAAACAGGGGGGG - Intergenic
1175576649 20:60065528-60065550 GAAAATGCAGAAAACTGGGGAGG + Intronic
1175685832 20:61028141-61028163 GGATATAGAAAGAGCTGGGGAGG - Intergenic
1177203748 21:17987113-17987135 GAATAGAGAAATAGATGGGGAGG + Intronic
1177626760 21:23672250-23672272 GAAGGGAGAAAAAACTGGGTTGG - Intergenic
1177939840 21:27396201-27396223 GAATTTAGGAAGAACTGAGGTGG + Intergenic
1178905311 21:36631559-36631581 GAAGATGGAAAAAAGCGGGGTGG + Intergenic
1180715579 22:17869923-17869945 GAACAAAGAATAAGCTGGGGAGG - Intronic
1182137900 22:27922998-27923020 GAAAAAAGAAAAAACAGGGCCGG - Intergenic
1184077289 22:42189903-42189925 GAAAAGAGAGAAAGCTGGGGCGG + Intronic
949247839 3:1946375-1946397 GAATAAAGATAAAACTGATGAGG - Intergenic
950380072 3:12605435-12605457 AAAAATACAAAAAACTGGGTGGG - Intronic
950520901 3:13497158-13497180 AAAGAAAGAAAAAACTGGTGAGG - Intronic
950541397 3:13615348-13615370 GAACAGCGAAAAAACTGGGCTGG - Intronic
950727946 3:14930434-14930456 AAAAATAGAAAAAATTAGGGAGG + Intronic
950884646 3:16352805-16352827 GAAAATAGAAAAAGCAGGTGTGG + Intronic
951970078 3:28433909-28433931 AAAAAAAAAAAAAACTGGGGTGG - Intronic
952464675 3:33569884-33569906 AAAAATAGAAAAAAATGAGGAGG + Intronic
952518008 3:34125063-34125085 GAAAATAGAAAAAACTCAGCAGG - Intergenic
952680927 3:36091360-36091382 AAATATAGTAAAAAATGAGGGGG - Intergenic
952982043 3:38744203-38744225 GAATATAAGATAAACTGGAGTGG + Intronic
956043416 3:65170468-65170490 GAATAGAGCAAAAACTGTAGGGG - Intergenic
957321490 3:78636859-78636881 CAATAGAGAGAAAACTGGAGTGG - Intronic
957591784 3:82208318-82208340 GAATATAAAAAAGTGTGGGGAGG + Intergenic
959090936 3:101901985-101902007 GGATACAGAGAAAACAGGGGCGG - Intergenic
959779323 3:110209462-110209484 GAATATAGATAAAAATTGTGGGG + Intergenic
960170215 3:114452071-114452093 GAAAAAAGAAAAAAAAGGGGGGG + Intronic
960585755 3:119320103-119320125 GAATGTAGCATAAACTGGTGAGG - Intronic
960835352 3:121900951-121900973 TAATATATAAATGACTGGGGTGG - Intronic
961134367 3:124496279-124496301 GAAGAGAAAAAAAACAGGGGTGG - Intronic
962428192 3:135293416-135293438 GATAATAGGAGAAACTGGGGTGG + Intergenic
964074962 3:152682712-152682734 AAAGAAAGCAAAAACTGGGGAGG - Intergenic
966161106 3:176969389-176969411 GAAAATACAAATAAGTGGGGAGG - Intergenic
966380788 3:179342839-179342861 GGATATGGAAAAAATTGGGTAGG + Intergenic
966459858 3:180165059-180165081 GACTATAGAAAATGCTGGGTGGG + Intergenic
966646395 3:182250469-182250491 GGATAGAGAAAACAATGGGGTGG - Intergenic
966791429 3:183674013-183674035 AAATATAGAAAAAACAGGTTTGG - Intronic
967143857 3:186589047-186589069 GAATATAGAAACAAAACGGGAGG + Intronic
967165948 3:186779603-186779625 GAAAATGGAGAAAACTGAGGAGG - Intergenic
967409292 3:189151301-189151323 CAATATAGAAAAAGCTGATGTGG + Intronic
967993911 3:195152570-195152592 GAAAATATAAAAATCTGGGGAGG + Intronic
972419099 4:38869425-38869447 GAATGGAGAAAAGACTGGTGAGG + Intronic
972570070 4:40302622-40302644 GAAGATAGTAAAAACTGGGAAGG + Intergenic
972739831 4:41878890-41878912 CAAAATAGAAAGAGCTGGGGAGG - Intergenic
972763792 4:42132603-42132625 GAAAATAGAAAAAATTAGTGGGG - Intronic
972879207 4:43402984-43403006 GGATATAGTAAAAACTGTGAGGG - Intergenic
973550532 4:52031212-52031234 GAGCACAGAAAACACTGGGGGGG - Intronic
975347063 4:73304229-73304251 ACATATAGAAAAATCGGGGGAGG - Intergenic
975796888 4:78015482-78015504 GAATGTTGAAAAAACGGTGGTGG + Intergenic
975939895 4:79630017-79630039 TAATAGAGAAAACACTTGGGAGG - Intergenic
976258233 4:83120892-83120914 GATAATATAAAAAACTCGGGGGG - Intronic
976433140 4:84987192-84987214 GAATATGGAAAAATAGGGGGTGG + Intergenic
978721429 4:111914773-111914795 GAAAATAAAAAAAAATGGGCAGG - Intergenic
979844073 4:125486034-125486056 GAATATACCACAAATTGGGGTGG - Intronic
979894529 4:126143349-126143371 TAATACAGAAAAAATTGGAGGGG + Intergenic
979939779 4:126746746-126746768 GAAAATAAAAAATACTGAGGAGG + Intergenic
980322533 4:131297479-131297501 GACTATAGAAAATCCTGGAGAGG - Intergenic
981292210 4:143089423-143089445 GAATATAGAAGAATGTGTGGAGG + Intergenic
983192007 4:164764582-164764604 AAAAATAGAAAAAAATGTGGTGG + Intergenic
983458915 4:168002812-168002834 GATAATAGGAAAAACTGGGTAGG + Intergenic
984088071 4:175336444-175336466 GAATACAGAAAAAAATGGCCAGG + Intergenic
984500970 4:180558189-180558211 GAAAATAAAAACAAATGGGGAGG + Intergenic
987623676 5:20369557-20369579 GAATATGGGAACAACTGCGGTGG - Intronic
988258632 5:28852965-28852987 GAGTATAGAAAAAAATGCGTTGG - Intergenic
988385325 5:30556943-30556965 GAAAATACAAAAAAATGGTGGGG - Intergenic
989223742 5:39000813-39000835 TAATATATAAAAAAATTGGGGGG - Intronic
989773186 5:45169342-45169364 GGATATACAAAAATTTGGGGAGG - Intergenic
989969329 5:50503539-50503561 GAATATTGTGAAAACTGGGTAGG - Intergenic
989987735 5:50721511-50721533 GAATTAAGAAAAAAATGGGAGGG - Intronic
990592390 5:57279701-57279723 GAATAAAGAAAAGACTGGGCTGG + Intergenic
991756844 5:69882250-69882272 GTATATAAAAAAAAAAGGGGGGG + Intergenic
991836247 5:70758132-70758154 GTATATAAAAAAAAAAGGGGGGG + Intergenic
991884797 5:71252266-71252288 GTATATAAAAAAAAAAGGGGGGG - Intergenic
991999289 5:72419195-72419217 GTATATTGAAAAAAAAGGGGGGG - Intergenic
992018468 5:72599068-72599090 CAATATAGAACAATATGGGGGGG + Intergenic
992197562 5:74354935-74354957 GAATCTAGAAAAACCTCGTGGGG - Intergenic
992215172 5:74518651-74518673 GAGGGTAGAAAAACCTGGGGAGG - Intergenic
992980546 5:82166613-82166635 GAGAATAAAAAAGACTGGGGGGG - Intronic
993190477 5:84673558-84673580 GAAAACAGAAAAATCTGGTGGGG - Intergenic
993727270 5:91382249-91382271 GAATAGAGAAAAAACACGTGGGG + Intronic
993978177 5:94508524-94508546 GAATATGAAAAAAAAGGGGGGGG + Intronic
994838352 5:104886833-104886855 GAGTAAAGGAAAAACTGGAGGGG - Intergenic
994991802 5:107006189-107006211 AAAGATAGAGAAAACTGCGGAGG + Intergenic
995089746 5:108160489-108160511 GAATATAGAGTGAACTGGGTTGG + Intronic
995258978 5:110079513-110079535 GAATAAAGAAAATATTTGGGAGG + Intergenic
995720579 5:115128074-115128096 GGCTATAAAAAAAATTGGGGGGG + Intronic
995916493 5:117251993-117252015 GAATATAGAAGAAAGTGGAGAGG - Intergenic
996445934 5:123550340-123550362 GAATAAAGAAAAAAAGGGGCAGG + Intronic
996676609 5:126182462-126182484 GAAAAGAAAAAAAACTGGTGTGG - Intergenic
998056047 5:139078372-139078394 GAATTTAAAAAAAAAAGGGGAGG + Intronic
998058101 5:139096565-139096587 GAAGAGAGAAAAGAGTGGGGAGG + Intronic
998400597 5:141846760-141846782 GAAAAAAGAAAAAAATGGAGGGG - Intergenic
999226453 5:150028862-150028884 AAATAAAGAAGACACTGGGGAGG - Intronic
999730499 5:154473608-154473630 GAAAAAAGAAAAAAGTAGGGGGG + Intergenic
1000347377 5:160325878-160325900 GAATATATAAACAAATGGGTGGG - Intronic
1000720606 5:164701913-164701935 GAGTATTGTAAAAAGTGGGGAGG - Intergenic
1001349627 5:170947487-170947509 GAAGATAGGAAATGCTGGGGGGG + Intronic
1002407723 5:179048964-179048986 CAATATAGAACAATATGGGGGGG + Intergenic
1003098811 6:3161796-3161818 GTATTTAAAAAAAACTTGGGGGG - Intergenic
1003882647 6:10492362-10492384 GAATAAAGAATCAACTGGGTGGG + Intronic
1005069389 6:21850431-21850453 GAGTGTAAAAGAAACTGGGGGGG + Intergenic
1005101299 6:22174832-22174854 TAATAAAAAAAAAAGTGGGGGGG - Intergenic
1006077328 6:31542225-31542247 GAATAAAGATAACAGTGGGGGGG - Exonic
1006769654 6:36542129-36542151 AAATATAGAAAAACATGGGCTGG - Intronic
1007195256 6:40055168-40055190 GAATAGAGAAAAAGCAGGGCAGG + Intergenic
1007510236 6:42369147-42369169 GGATCTAAAAAAAACTGAGGAGG + Intronic
1008052576 6:46915150-46915172 GAGTATAGAACAAACTGGGCCGG - Intronic
1008795978 6:55303511-55303533 GCAAATAGAATAAAATGGGGAGG + Intergenic
1009360110 6:62801103-62801125 GAATATAGCAGATACTTGGGTGG + Intergenic
1009412635 6:63384150-63384172 AAGCATGGAAAAAACTGGGGAGG - Intergenic
1009450118 6:63790729-63790751 GGATATAGAAGAAATTGGGAGGG + Intronic
1009966913 6:70587542-70587564 GTATATGGAAAAAACAGGAGAGG - Intronic
1011344721 6:86356237-86356259 GTAAATACAAACAACTGGGGTGG + Intergenic
1011727409 6:90224450-90224472 GAATATGAAAAATACTGGGATGG + Intronic
1011840703 6:91494796-91494818 AAATAGAGAAAAAATTGGGGTGG - Intergenic
1013818701 6:114130438-114130460 GTTTATAGAAAAATCTGGGGTGG + Intronic
1015020136 6:128463252-128463274 GAATATAGGACAAACTTGGAAGG - Intronic
1016074305 6:139777969-139777991 GAATATTGAGAAAACTAAGGGGG - Intergenic
1016721257 6:147301595-147301617 TAATATAGATAAATCTGGGCTGG - Intronic
1018193131 6:161328807-161328829 TAAGATAGGAAAAAATGGGGGGG - Intergenic
1020952997 7:14704465-14704487 GAAAAAAGAAAAAAAGGGGGAGG + Intronic
1021598952 7:22344749-22344771 AAAAAAAGAAAAAAGTGGGGAGG - Intronic
1021636451 7:22698953-22698975 GCATATAGAAAAAGTGGGGGAGG + Intergenic
1022706661 7:32808097-32808119 GTATAAAGAAAAAACTGGGCTGG - Intergenic
1022942284 7:35252572-35252594 GAAGAAAGGAAAAATTGGGGAGG + Intronic
1023380859 7:39607224-39607246 GGACATAGACAACACTGGGGAGG - Intronic
1023514230 7:40984525-40984547 GAATATAGGAAAAAATTGAGGGG - Intergenic
1024212510 7:47218035-47218057 CAATATAGAACAATATGGGGGGG + Intergenic
1025141926 7:56473988-56474010 GGACAGAGAAAAAAATGGGGAGG - Intergenic
1025242883 7:57292822-57292844 GAATACAGATAAAACTTGGCCGG + Intergenic
1025949378 7:66131648-66131670 GAATATAGATAAAATTTCGGAGG - Intronic
1026423441 7:70265019-70265041 GAATATAAAATAAACTGAAGGGG - Intronic
1026796959 7:73372285-73372307 GAAAAAAAAAAAAGCTGGGGGGG - Intergenic
1026992678 7:74596163-74596185 GAAAATAGAAAAATCAGGGCCGG + Intronic
1027279518 7:76596511-76596533 TAATAAAGAAAAAAATAGGGAGG + Intergenic
1028226539 7:88258489-88258511 GAATATAGAATAGACTGTGTAGG - Intergenic
1028405443 7:90469023-90469045 GGATATGGCAAAAATTGGGGAGG - Intronic
1028619687 7:92811455-92811477 GAAGGAAGAACAAACTGGGGTGG + Intronic
1028782110 7:94749155-94749177 CAATATCGTAAGAACTGGGGGGG + Intergenic
1030106417 7:105990993-105991015 GCAAATAGAGAAACCTGGGGTGG + Intronic
1030668738 7:112310525-112310547 GAAGAAAGAAAAAAGTAGGGTGG - Intronic
1030863492 7:114668370-114668392 GAATAAAGCGAAAACTGGAGTGG - Intronic
1030937715 7:115606295-115606317 GAGTATAGAAAGAACTGTGCTGG - Intergenic
1031275674 7:119719839-119719861 AAAAAAAGAAAAAACTGGGGTGG + Intergenic
1033279794 7:139997682-139997704 GAAGGGAGAAGAAACTGGGGAGG + Intronic
1033832919 7:145275347-145275369 GAATTCAGAAGAAACTTGGGTGG - Intergenic
1034862249 7:154608272-154608294 GTATTTAGAAAAAACTAGGTGGG - Intronic
1035179009 7:157075963-157075985 GAATCTGGTAAAAGCTGGGGTGG - Intergenic
1035957303 8:4095113-4095135 GGATATGGAAAGAACTTGGGAGG + Intronic
1035971298 8:4252156-4252178 GGATATATAGAAAGCTGGGGTGG + Intronic
1036076866 8:5512181-5512203 GAATTTAGTAAAAGCTGGGCTGG - Intergenic
1036246515 8:7121912-7121934 GAAGATAGAGAAAATTGGCGTGG - Intergenic
1036490303 8:9219025-9219047 GAAGTTAGAGAATACTGGGGAGG + Intergenic
1036984309 8:13509877-13509899 GAATAATGAAAAAACTGTTGAGG + Intronic
1037071901 8:14660764-14660786 AAATAAAGAAGAAACTGGAGAGG + Intronic
1037091658 8:14927268-14927290 AAATATAGAAAAAAATTAGGCGG - Intronic
1037164720 8:15812797-15812819 GAAGAAAGAAAAAAATGGGCTGG + Intergenic
1039167032 8:34693818-34693840 AAATATTGAAGAAACTGGAGTGG - Intergenic
1040369918 8:46759351-46759373 GAATATAGAAAAGCCCTGGGAGG - Intergenic
1040745950 8:50642722-50642744 GAAGACAGAAAATACTGGGAAGG - Intronic
1041179211 8:55230259-55230281 AAAACTAGAAAAAACTAGGGAGG + Intronic
1041841156 8:62273048-62273070 CAATACAGAAATCACTGGGGTGG + Intronic
1042333231 8:67604737-67604759 GATTAGAGAAAAATCTGTGGAGG + Intronic
1044935938 8:97293377-97293399 TATTATAGAAGAAGCTGGGGTGG + Intergenic
1046003327 8:108447518-108447540 GAATATATAAAAAAATGAAGTGG + Intronic
1046154684 8:110272545-110272567 GACTATAGAAAAAAGAGAGGAGG + Intergenic
1046303600 8:112331754-112331776 GGATATAAAGAAAACTGGGTGGG + Intronic
1048839851 8:138555874-138555896 GAATATAGAAAACAGTATGGGGG + Intergenic
1051038765 9:12780836-12780858 GAGTATAGAGTAAAATGGGGAGG - Intronic
1051580978 9:18674041-18674063 GAAGGTAGAAAAAAATGGGATGG + Intronic
1051609864 9:18950558-18950580 GAATTTGGAAAAAACTGAGAAGG + Intronic
1051743542 9:20274227-20274249 GGATATAGCCAAAACAGGGGAGG + Intergenic
1052163824 9:25296759-25296781 GAAGTTAGAAAAAAATAGGGTGG - Intergenic
1052507967 9:29379378-29379400 AAAAATAGAAAAAAAGGGGGGGG + Intergenic
1052617759 9:30864371-30864393 AAATATAGAGAAAACTGGCCAGG - Intergenic
1052854296 9:33397545-33397567 GAATAGAGCAAAGACTGGGATGG + Intronic
1055236466 9:74128882-74128904 GATTATAGCAAGATCTGGGGTGG - Intergenic
1055307977 9:74950731-74950753 GAAAATAGAAAAACGTTGGGAGG + Intronic
1055410372 9:76022471-76022493 GAATAGGGAAAGACCTGGGGTGG + Intronic
1057296609 9:93848361-93848383 GAATAGAGAGGAAGCTGGGGTGG + Intergenic
1057570061 9:96197665-96197687 AATTAAAGAAAAAAGTGGGGTGG + Intergenic
1057851034 9:98567001-98567023 GCATCTAGAAAGAACTGGAGAGG - Intronic
1057963135 9:99476583-99476605 GAGTGGAGACAAAACTGGGGAGG - Intergenic
1058502056 9:105630210-105630232 GAAAAAAGAAAAATCTGGGATGG + Intronic
1058615159 9:106818346-106818368 CAATTTAGAAGAAAGTGGGGTGG + Intergenic
1058972410 9:110095713-110095735 GAATATAGCACAAGATGGGGAGG - Intronic
1059223751 9:112652160-112652182 GAATAAAATAAAAACTGGGCTGG - Intronic
1059282154 9:113144205-113144227 AAAGAAAGAAAAAAATGGGGAGG - Intergenic
1060634781 9:125191312-125191334 AAAAATACAAAATACTGGGGAGG + Intergenic
1061122637 9:128653416-128653438 AAAAATAAAAAAAACTGGGCCGG + Intronic
1061125537 9:128672861-128672883 AAAAATACAAAAAACTGGTGGGG + Intergenic
1061473644 9:130847711-130847733 GAATAGAGCAAGAACTGGAGAGG + Intronic
1186165064 X:6819144-6819166 CAATATATTAAAGACTGGGGTGG + Intergenic
1186367790 X:8913507-8913529 GAATACAGAAAAATCTGGTGTGG - Intergenic
1186968623 X:14815316-14815338 TAATTTAAAAAAAAGTGGGGGGG + Intergenic
1187509630 X:19906029-19906051 GTATATGGAAAAAAACGGGGAGG + Intergenic
1188430420 X:30100720-30100742 GAACATAGAAAAGACTGATGTGG + Intergenic
1189058382 X:37725434-37725456 GACTACAGAAAATACTGGTGGGG + Intronic
1189949355 X:46212994-46213016 GTATATAGAAAACACTGGCCGGG - Intergenic
1190608279 X:52167581-52167603 GAATATTGAAAAAACAAGGTAGG + Intergenic
1192106254 X:68320540-68320562 GAATATAGAAAAATGGGGGGGGG - Intronic
1192329228 X:70161049-70161071 GAATAGAGCAAAAGCAGGGGTGG - Intronic
1193686805 X:84586822-84586844 TAAAAAAAAAAAAACTGGGGTGG - Intergenic
1193915439 X:87357065-87357087 GAAGAGAGAAAAGAGTGGGGAGG + Intergenic
1194157898 X:90415857-90415879 GAGTAGAGAAAATAGTGGGGAGG - Intergenic
1194381290 X:93194367-93194389 GAAGATAGCAAAAACTTGGTTGG - Intergenic
1194641675 X:96410338-96410360 GACCATAGAATAATCTGGGGAGG - Intergenic
1195252485 X:103063013-103063035 GAATATGGAAAGGATTGGGGAGG - Exonic
1195278684 X:103309706-103309728 GAATATGGAAAGGATTGGGGAGG - Exonic
1195391664 X:104368617-104368639 CAAAAAAGAAAACACTGGGGTGG - Intergenic
1195769768 X:108338143-108338165 TAATAGAGAAATCACTGGGGAGG + Intronic
1196508461 X:116476976-116476998 GAGGAGAGAAAAGACTGGGGAGG - Intergenic
1196891394 X:120294136-120294158 GATAAAAGAAAAAACTGGGCCGG + Intronic
1197660244 X:129162861-129162883 GAATATGGAAAAAATTGTGGAGG - Intergenic
1197801541 X:130354715-130354737 CAATAAATAAAAAAATGGGGTGG - Intronic
1198953959 X:142106418-142106440 GAATTTAGAAAAGACTGTGAAGG - Intergenic
1199667421 X:150110063-150110085 GAATATGGGAAAAACAGAGGGGG - Intergenic
1200504224 Y:3992826-3992848 GAGTAGAGAAAATAGTGGGGAGG - Intergenic
1201074979 Y:10180071-10180093 GAAAATAAAAGAAAATGGGGAGG - Intergenic
1201256477 Y:12112716-12112738 GAATATAAAAGAAAGGGGGGAGG - Intergenic
1201680121 Y:16636508-16636530 CAATATAGAAAAATATGGGGGGG + Intergenic