ID: 1064881336

View in Genome Browser
Species Human (GRCh38)
Location 10:20057774-20057796
Sequence TTCCATGTGGGCTAAACTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064881332_1064881336 2 Left 1064881332 10:20057749-20057771 CCAAGGTGAAGCACATTAGTCCT 0: 1
1: 0
2: 0
3: 10
4: 101
Right 1064881336 10:20057774-20057796 TTCCATGTGGGCTAAACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064881336 Original CRISPR TTCCATGTGGGCTAAACTGT AGG Intronic
No off target data available for this crispr