ID: 1064894381

View in Genome Browser
Species Human (GRCh38)
Location 10:20217555-20217577
Sequence CCTTCTGTAGGGAGGCTGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 228}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064894381 Original CRISPR CCTTCTGTAGGGAGGCTGGT GGG (reversed) Exonic
900153946 1:1196581-1196603 GCTTCTGCAGGGAGGCAGGGAGG - Exonic
901237077 1:7672896-7672918 CCTTCTGGAGCCAGGCAGGTGGG - Intronic
901788108 1:11637877-11637899 CCTTCTGGAGTGAGCCTGCTTGG + Intergenic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
902776085 1:18675936-18675958 CCTGGTGCAGGGATGCTGGTGGG - Intronic
903751420 1:25623670-25623692 CCCTGTGTAGGGAAGCTGCTTGG + Intronic
904111619 1:28130652-28130674 CTTTTTGTGGGGAGGCTGGGTGG - Intergenic
908114348 1:60926229-60926251 CCTTCTGTTAGTAGGCTTGTTGG - Intronic
910470553 1:87547957-87547979 GTTTCTGTAGGGAGGATGATTGG + Intergenic
911281906 1:95940272-95940294 ACTTCTGCAGTGAGGATGGTGGG - Intergenic
911589280 1:99728041-99728063 CTTTCTCTAGGGAGGCGGGGAGG - Intronic
913495278 1:119422678-119422700 CCTTCTGTATGAAGCCAGGTGGG - Exonic
915705091 1:157836128-157836150 CCATCTGGAGTGCGGCTGGTGGG - Exonic
916605299 1:166336323-166336345 CCTTCTCCAGGGCGGCTGGCTGG + Intergenic
920265084 1:204715642-204715664 CCTTCTGAGTGGAGGCTGTTAGG + Intergenic
920297556 1:204968204-204968226 CCTTCTGGAAGGAGGCTCATGGG + Intronic
920967163 1:210710949-210710971 CATTTTGAAGGGAAGCTGGTGGG - Intronic
921482496 1:215679071-215679093 CCACATGTAGGCAGGCTGGTGGG + Intronic
1064894381 10:20217555-20217577 CCTTCTGTAGGGAGGCTGGTGGG - Exonic
1067945550 10:50686101-50686123 CCTGCTTTAGGGAGGCTTCTTGG + Intergenic
1067947125 10:50696631-50696653 CCTTCTGAAGGGAAGCTGGAAGG - Intergenic
1068970783 10:62956250-62956272 CCTTCTGTCAGGTGTCTGGTAGG + Intergenic
1069678435 10:70266363-70266385 ACTGCTGTTGGGAGGCTGGGAGG + Exonic
1070867061 10:79712974-79712996 CCTGCTTTAGGGAGGCTTCTTGG + Intronic
1070880851 10:79851095-79851117 CCTGCTTTAGGGAGGCTTCTTGG + Intergenic
1070882436 10:79861621-79861643 CCTTCTGAAGGGAAGCTGGAAGG - Intergenic
1071633975 10:87235197-87235219 CCTGCTTTAGGGAGGCTTCTTGG + Intronic
1071647423 10:87367414-87367436 CCTGCTTTAGGGAGGCTTCTTGG + Intronic
1071649006 10:87377932-87377954 CCTTCTGAAGGGAAGCTGGAAGG - Intergenic
1072615131 10:97043994-97044016 CCATCTCTAGGGAGGCAGGCAGG - Intronic
1072898977 10:99390960-99390982 CCTTCTGCAGTGGGGCAGGTGGG - Intronic
1073273105 10:102283540-102283562 CCTTCTGCTAGGAGGCTGGGAGG + Intronic
1074766356 10:116702830-116702852 CATTTTGGAGGGAGGTTGGTTGG - Intronic
1075879911 10:125842198-125842220 CCTACTGCAGGGAGGCTGGCAGG - Intronic
1076569446 10:131422867-131422889 CCTGCTGTAGGGAGCCTGTCGGG - Intergenic
1076569469 10:131422955-131422977 CCTGCTGTAGGGAGCCTGTCAGG - Intergenic
1076895733 10:133310468-133310490 CCTGCCGAAGGGAGGCTGGAGGG + Intronic
1077195400 11:1277341-1277363 CCTTCCTCAGGGAGGCCGGTGGG - Intronic
1077531909 11:3101374-3101396 CCTTTTGTAGGGACGCTGTGGGG - Intronic
1078713311 11:13816009-13816031 CCTTGAGTAGGGAGGGAGGTGGG + Intergenic
1078872630 11:15363151-15363173 CCTTCTGGATGGAGGTAGGTGGG + Intergenic
1079330339 11:19527836-19527858 CCCTCTGTAGGAGTGCTGGTGGG - Intronic
1080605866 11:33864554-33864576 CCCTCGGAAGGGAGGCTGGGTGG - Intronic
1081375267 11:42351093-42351115 CCTTCTGCAGAGAACCTGGTAGG + Intergenic
1083303483 11:61750995-61751017 ACTGCTTTAGGTAGGCTGGTTGG + Intergenic
1084631162 11:70351859-70351881 CCTTCTGTAGGAACGCTGCCAGG - Intronic
1085447593 11:76611000-76611022 CCTCCTGCAGGGATGCTGGTGGG + Intergenic
1089573292 11:119423648-119423670 CTTTCTGAAAGGAAGCTGGTTGG + Exonic
1089962044 11:122624954-122624976 CCCTCTGTATGGAGGTAGGTGGG + Intergenic
1090424321 11:126596483-126596505 CCTTCTGAAGGGGGGAAGGTAGG + Intronic
1093764832 12:22951681-22951703 CCTTATGTAGGTAGACTGGACGG + Intergenic
1098683242 12:73384860-73384882 TCTTCTGTAGGTTGGCTGGATGG + Intergenic
1101332191 12:103766119-103766141 CCTTGTGTTGGGAGGCAGGATGG - Intronic
1101946247 12:109139678-109139700 GCTTCTGGTGGGAGGGTGGTAGG - Exonic
1102513094 12:113428851-113428873 CCTAGGGTTGGGAGGCTGGTAGG - Intronic
1103211205 12:119167873-119167895 CCTTATGGAGGGTGGCAGGTGGG - Intergenic
1103518764 12:121524142-121524164 CTTTCTGCAGGGAGGGAGGTAGG - Intronic
1103575339 12:121873249-121873271 CCAGCTGTAGGGAGACTGGTTGG + Intergenic
1103899762 12:124297179-124297201 CCCTCTGTAAGGAGGCTTCTGGG - Intronic
1104755790 12:131268694-131268716 ACTGCAGTTGGGAGGCTGGTGGG - Intergenic
1110257208 13:73445323-73445345 ACTTCAGTGGGCAGGCTGGTTGG - Intergenic
1112800102 13:103100918-103100940 TCTTCTGTAAGGAGTCTGTTGGG + Intergenic
1113458528 13:110465767-110465789 GCTGCTGAGGGGAGGCTGGTGGG - Intronic
1113691876 13:112316822-112316844 CCTTCAAGATGGAGGCTGGTAGG + Intergenic
1114458862 14:22874273-22874295 CAATCTGTGGAGAGGCTGGTGGG + Intronic
1116166981 14:41346398-41346420 CCTTTTGAAGGGAGGAGGGTGGG + Intergenic
1118651781 14:67903903-67903925 CCTACTTGAGGGTGGCTGGTGGG - Intronic
1118964064 14:70562986-70563008 CCTACTGTAGGGAGTATGGTTGG - Intergenic
1119287169 14:73464854-73464876 CCTTCTGTCTGGATTCTGGTTGG - Intergenic
1120952662 14:90056946-90056968 ACCTCAGTAGGCAGGCTGGTTGG - Intergenic
1120984826 14:90325478-90325500 CATTCAGTAAGGAGTCTGGTGGG - Intronic
1122243298 14:100383413-100383435 CCATCTGGAGGGTTGCTGGTGGG + Intronic
1122742694 14:103881248-103881270 GCCTCTGTAGAAAGGCTGGTGGG - Intergenic
1125759316 15:42086116-42086138 CCACCTGTTGGGAGGCTGCTGGG - Intronic
1130224144 15:82045179-82045201 CTTTCTGGAGGTGGGCTGGTTGG + Intronic
1131896150 15:97031990-97032012 CCTTCTGGAGGGTGGATGGTAGG + Intergenic
1132022376 15:98373740-98373762 GCCTCTGGAGAGAGGCTGGTAGG - Intergenic
1132828554 16:1916807-1916829 CCTGCTGCAGGGAGGAGGGTAGG - Intronic
1132905505 16:2280629-2280651 CCTTCTGCGGGGGAGCTGGTGGG + Intronic
1133809373 16:9149299-9149321 CCTTCTTTCGGGATGGTGGTGGG + Intergenic
1136000349 16:27287789-27287811 ACTTCTAGAGGGAGGATGGTAGG + Intronic
1139469994 16:67173296-67173318 GCTTCAGTAGGGAGACAGGTGGG + Intronic
1139543817 16:67639207-67639229 CCTGCTTGAGGGAGGCTGGGGGG + Intergenic
1140942078 16:79731411-79731433 ACATCTGTAGGGAGGCTGAAAGG + Intergenic
1142018472 16:87765462-87765484 CCCTCTGAAGGGAGGCTGGGTGG - Intronic
1142122976 16:88396415-88396437 CCTCCTGAAGGGAGGCTGGGAGG + Intergenic
1142122985 16:88396442-88396464 CCTTATGAAGGGAGGCCGGGCGG + Intergenic
1142122994 16:88396469-88396491 CCTCCTGAAGGGAGGCCGGGAGG + Intergenic
1142123012 16:88396523-88396545 CCGTCTGAAGGGAGGCCGGGAGG + Intergenic
1142123029 16:88396577-88396599 CCTCCTGAAGGGAGGCCGGGCGG + Intergenic
1142123039 16:88396604-88396626 CCATCTGAAGGGAGGCCGGGAGG + Intergenic
1142123048 16:88396631-88396653 CCTCCTGAAGGGAGGCCGGGCGG + Intergenic
1142123058 16:88396658-88396680 CCTCCTGAAGGGAGGCCGGGAGG + Intergenic
1142123075 16:88396712-88396734 CCTCCTGAAGGGAGGCCGGGAGG + Intergenic
1142123115 16:88396847-88396869 CCTCCTGAAGGGAGGCCGGGAGG + Intergenic
1142123125 16:88396874-88396896 CCTCCTGAAGGGAGGCCGGGTGG + Intergenic
1142123160 16:88396982-88397004 CCTCCTGAAGGGAGGCCGGGAGG + Intergenic
1142123170 16:88397009-88397031 CCTCCTGAAGGGAGGCCGGGAGG + Intergenic
1142186584 16:88697722-88697744 CCTGCTGGAGGGAGGCAGGAAGG - Intronic
1142288879 16:89183634-89183656 CCTCCTGCAGGAAGGCTGGCCGG - Exonic
1144473128 17:15562250-15562272 CCCTCTGTAGCCAGGCTGGATGG + Intronic
1144495229 17:15741568-15741590 CCATCTGTAGGGAGGGAGGGTGG - Intronic
1144923353 17:18782470-18782492 CCCTCTGTAGCCAGGCTGGATGG - Intronic
1146129480 17:30259008-30259030 CCCTCTTTAGGGAGGATGTTAGG - Intronic
1146950457 17:36901730-36901752 TCTTCTGCAGCGAGGCTGGTGGG + Intergenic
1149469010 17:56901261-56901283 CCCTCTGTCTGGAGGCTGGTGGG - Intronic
1150640445 17:66946189-66946211 CCCGCTGGAGGGAGGCTGGAAGG - Intergenic
1151246048 17:72795670-72795692 TCTTCTGTTGGGAGGATGGGTGG - Intronic
1152114832 17:78378981-78379003 CCTTCTTGAGGGAGGGTGGGCGG + Intronic
1152813582 17:82393927-82393949 CCTTCAGTAGTGTGGATGGTGGG - Intronic
1153229303 18:2921164-2921186 CCTGCAGAAGGGAGGCAGGTTGG + Intronic
1154201324 18:12302556-12302578 CCTGCTGCAGGGAGGCTGGTGGG - Intergenic
1155540488 18:26863826-26863848 GCTTCTCTGGGGAGGGTGGTGGG + Intronic
1155593466 18:27454494-27454516 ACCTCAGTGGGGAGGCTGGTTGG + Intergenic
1155784459 18:29879820-29879842 ACTTCAGTGGGCAGGCTGGTTGG + Intergenic
1157374883 18:47153369-47153391 CCTGCTTTAGGGAGGGTGGGAGG - Intronic
1157863169 18:51159804-51159826 CCCTCGGCAGTGAGGCTGGTAGG - Intergenic
1160021214 18:75183444-75183466 ACTTCTCTACGGAGGCTGCTGGG - Intergenic
1160816077 19:1036397-1036419 CCATCTGCAGGGAGGTTCGTGGG - Exonic
1163442117 19:17327566-17327588 CCTTCTGCAGGGCGGCAGGAGGG + Exonic
1163586756 19:18168555-18168577 CCGTCTGGAGGGAGGCAGGGAGG + Intronic
1166917711 19:46206977-46206999 CCTTCTGCTGGGAGGAGGGTGGG - Intergenic
1167247307 19:48381365-48381387 CCCTCTGTAGGGATGCTGTGAGG + Intergenic
1167652780 19:50742132-50742154 CTCCCTGTGGGGAGGCTGGTTGG + Intergenic
1167833645 19:52048549-52048571 CCTTTTGGAGGGGAGCTGGTAGG - Exonic
925046142 2:774112-774134 CCTGCTGTGGGGAGGCAGGATGG - Intergenic
925101779 2:1253221-1253243 CCTTCTGTGGGGAGGAGGGTGGG - Intronic
927699422 2:25258475-25258497 CCTGCAGTAGGTAGGCTGGGGGG + Intronic
928408677 2:31035851-31035873 ACTACTGTAGGGTGGATGGTGGG + Intronic
929039869 2:37734024-37734046 CCTTCTGTGGGGAGCCTGAGGGG - Intronic
930716315 2:54596828-54596850 CTCTCTGTAGGGAGGAGGGTTGG + Intronic
930928254 2:56847999-56848021 CCTGTTGGAGGGTGGCTGGTGGG + Intergenic
937727568 2:125185939-125185961 ACTTCAGTGGGCAGGCTGGTTGG + Intergenic
938654086 2:133412941-133412963 CCTTCTGCAGGGAGGGAGGAAGG + Intronic
942905389 2:181174154-181174176 CCTTCCCTAGTGATGCTGGTAGG - Intergenic
942951668 2:181728821-181728843 CCTCATGAAGGGAGGCTGATGGG - Intergenic
942984112 2:182119052-182119074 CCTGCTGTGGGGTGGGTGGTGGG - Intronic
945254164 2:207790208-207790230 CCAGCTGTTGGGAGGCTGGCAGG - Intergenic
946044533 2:216810395-216810417 CTTTCTGCAGGGAAGCTGGAAGG + Intergenic
946155064 2:217801842-217801864 CCTTCCGCAGGGATGCTGGGAGG + Exonic
947095381 2:226561202-226561224 GCTGCTTTAGGGAGGCAGGTTGG - Intergenic
1169473883 20:5912553-5912575 CCTTTTGTAGGGAAGATTGTAGG + Intronic
1170063837 20:12289077-12289099 CTTTCTGTAGGCAGGCTGAGAGG - Intergenic
1177358474 21:20038417-20038439 CCTTCTGGAAGGAACCTGGTGGG + Intergenic
1178479878 21:32970774-32970796 TCTTCTGTAGATAGGCTAGTTGG + Intergenic
1179314202 21:40226898-40226920 CCTTTTGGAGGGTGGATGGTGGG - Intronic
1179840644 21:44070806-44070828 TCTGCTGCAGGGATGCTGGTGGG + Intronic
1181639875 22:24190834-24190856 CATCCTGGAGGGAGACTGGTGGG - Intergenic
1182431608 22:30302176-30302198 CCTGCCTTAGGGAGGATGGTAGG + Intronic
1182714728 22:32348398-32348420 CCTTCTGTGCTGAGTCTGGTGGG + Intergenic
1183368136 22:37417916-37417938 CCTTCTGCAGGGAGGCGAGGGGG + Exonic
1183456335 22:37925176-37925198 CGGTCTGTAGGGAGCCAGGTGGG + Intronic
1185162262 22:49237066-49237088 CCCTGTGCAGGGAGGCTGGCTGG - Intergenic
1203292154 22_KI270736v1_random:5595-5617 CCTTCTGTGGGGAGCCTGAGGGG - Intergenic
949517527 3:4821010-4821032 CGCTCAGTGGGGAGGCTGGTGGG - Intronic
950469172 3:13174088-13174110 CCTGCTGTGGGGAAGCGGGTAGG - Intergenic
950716036 3:14848329-14848351 CCCTCTGCAGGGAGGCTTCTGGG + Intronic
952505863 3:34006307-34006329 CCTTCTGTAGGAAGGATGTTTGG + Intergenic
953044179 3:39280752-39280774 CCTGCAGTGGGGAGCCTGGTGGG + Intronic
954304049 3:49716305-49716327 CCTTCTGTAGAGAGGGCAGTGGG + Intronic
956259853 3:67327362-67327384 CCGCCTGAAGGGAGGCTGGTTGG + Intergenic
958804656 3:98795276-98795298 CCCTCTTTAGAGAGGCAGGTTGG - Exonic
961109624 3:124272958-124272980 CCTTCTGGTGGGAGGCTGGTTGG + Intronic
961311354 3:126004003-126004025 CCTTTGGGAGGGAGGCTGGGAGG + Intergenic
962282691 3:134064261-134064283 ACTTCTGCAGGAAGGCTGTTGGG + Intergenic
962922629 3:139964654-139964676 CCTTCTGGAGGGAGTGAGGTGGG + Intronic
964327766 3:155565549-155565571 GCTTCTCTGGGGAGGCTGGAGGG - Intronic
966339676 3:178911724-178911746 CATTCTGTAGGGTGCCTGTTTGG - Intergenic
967845726 3:194041146-194041168 TCTTCTCTAGGGAGGCAGTTGGG + Intergenic
967962073 3:194933500-194933522 TCTTCTGTTGGGTGGGTGGTGGG + Intergenic
968632907 4:1661407-1661429 CTTCCTGCAGGGAGGCGGGTGGG - Intronic
972203961 4:36748287-36748309 CTTTCTGTAGGCAGGTTGGTTGG - Intergenic
972782933 4:42301621-42301643 CCTTCGGGATGGGGGCTGGTTGG - Intergenic
973790577 4:54374465-54374487 CTTTCTGGATGGAAGCTGGTTGG + Intergenic
976177592 4:82370832-82370854 ACTTCTCTTTGGAGGCTGGTAGG - Intronic
978767054 4:112415030-112415052 ACTTCTCTGGGCAGGCTGGTGGG - Intronic
979169703 4:117585252-117585274 ACAAATGTAGGGAGGCTGGTAGG - Intergenic
981259357 4:142701284-142701306 CCTACTGTGGAGAGGCTGGCAGG - Intronic
983981933 4:174008491-174008513 CCTACTGGAGGGTGGCAGGTGGG - Intergenic
986737837 5:10681247-10681269 CCTTCCGCAGGGACGCTGGTGGG - Intronic
986737880 5:10681423-10681445 CTTCCTGCAGGGACGCTGGTGGG - Intronic
986737938 5:10681659-10681681 CTTCCTGCAGGGACGCTGGTGGG - Intronic
986737951 5:10681718-10681740 CTTCCTGTAGGGACGCTGGTGGG - Intronic
986737975 5:10681836-10681858 CTTCCTGTAGGAACGCTGGTGGG - Intronic
986737988 5:10681895-10681917 CTTCCTGCAGGGATGCTGGTGGG - Intronic
986738050 5:10682190-10682212 CTTCCTGCAGGGACGCTGGTGGG - Intronic
986738114 5:10682475-10682497 CTTCCTGCAGGGAAGCTGGTGGG - Intronic
986738129 5:10682534-10682556 CTTCCTGCAGGGACGCTGGTGGG - Intronic
988672788 5:33399972-33399994 ACTTCTGTATGGAGGCAGGGAGG - Intergenic
989094347 5:37767737-37767759 CCTTCTGGATGTAGGCTGATTGG - Intergenic
990394123 5:55357542-55357564 TCTTCTCCAGTGAGGCTGGTGGG + Intronic
999008311 5:148006365-148006387 CCTTCAGTGGGCAGGCTGGTTGG - Intergenic
1004785498 6:18963632-18963654 GCCTCTGTAGGGTGGCTGGTGGG - Intergenic
1006949858 6:37812810-37812832 CCATCTGTAGTGAGGCTGCCTGG - Intergenic
1007167090 6:39836308-39836330 CCTTCTTTAAGAAGGCTGGAAGG - Intronic
1007323013 6:41040732-41040754 CCCTCTTTAGGGCGGCTGGGAGG + Intronic
1008531791 6:52468101-52468123 CCATCTGGAGGCATGCTGGTAGG + Intronic
1010596682 6:77771778-77771800 CCTACTGTATGGTGGTTGGTAGG + Intronic
1014832118 6:126115124-126115146 CCTCCTGAAGGGTGGCTGGAAGG - Intergenic
1015717240 6:136205461-136205483 CCATCTGCAGGGGGGATGGTGGG - Intergenic
1015838810 6:137453728-137453750 CCTTTTGGAGGGTGGCTGGTGGG - Intergenic
1017909878 6:158783476-158783498 TCTTCAGTAGGTAGGGTGGTGGG - Intronic
1018063163 6:160106167-160106189 CATGCTGGAGGGAGGCTGGGCGG + Exonic
1018649129 6:165976813-165976835 CCTGCTGCAGGGTGGCTGGTGGG - Intronic
1019105809 6:169665829-169665851 CCTTCTGTCGGGAGGTGGGATGG - Intronic
1019413070 7:914993-915015 CCGGCTGCAGGGAGGCTGCTGGG - Intronic
1024152423 7:46585975-46585997 CCTTTTGTAGGGTGGAAGGTGGG + Intergenic
1024578889 7:50785679-50785701 CCTGGTGGAGGGAGGCTGGAAGG - Intronic
1025763338 7:64415762-64415784 TCTTCTGTGTGGTGGCTGGTGGG + Intergenic
1029331079 7:99856163-99856185 ACTTCTGCAGGTAGCCTGGTAGG - Intronic
1030139671 7:106291898-106291920 CCCTCAGTGGGCAGGCTGGTTGG - Intergenic
1030330185 7:108262277-108262299 CCTTCTGTCGGGGAGGTGGTGGG - Intronic
1031429285 7:121646787-121646809 CCTTCTTTAGGGTGGAGGGTGGG - Intergenic
1031670226 7:124533727-124533749 CCTTCTCTAGGCAGACTGGATGG - Intergenic
1032587902 7:133164572-133164594 CCTTCTGGAGTGTGACTGGTGGG - Intergenic
1033946134 7:146720369-146720391 CCTTCTCTAGGGAGGCTACCAGG - Intronic
1034025959 7:147704424-147704446 CCTTCTGAAGAAAGGGTGGTTGG + Intronic
1034887668 7:154810408-154810430 CCTGGTGTTGGGAGGCTGCTTGG + Intronic
1037278265 8:17204651-17204673 CCTTTTGGAGGGAGGAGGGTGGG + Intronic
1037362063 8:18084274-18084296 CCTTCTGCAGGTAGCCTGGAAGG - Intronic
1039012886 8:33114528-33114550 CCTTCTGCTGGGATGCTGGCAGG + Intergenic
1040783353 8:51137917-51137939 GATTCTGTAGGGTGGCAGGTTGG - Intergenic
1042163418 8:65921404-65921426 CCTTCTGTATGGGGGCTTCTTGG + Intergenic
1042804368 8:72755906-72755928 CATCCTGCAGGGAGGCTGGCTGG + Intronic
1043391284 8:79794736-79794758 CTTTCTGTACTGAGGCTGGCTGG - Intergenic
1044366353 8:91351201-91351223 CCTTTTGTCAGCAGGCTGGTTGG + Intronic
1044457720 8:92407447-92407469 CTGTCTGTAGGGATGCTTGTTGG + Intergenic
1044620547 8:94187303-94187325 GCTTCTCATGGGAGGCTGGTGGG - Intronic
1046024685 8:108708028-108708050 CCTACTTTAGGGTGGATGGTGGG - Intronic
1047849618 8:128842421-128842443 CACTCTGCAGGGAGGCTGATTGG + Intergenic
1048497863 8:134949883-134949905 CCTTCTGTGGTCAGGATGGTGGG + Intergenic
1049586101 8:143433038-143433060 CCTTGGGTTGGGAGGCTGGCGGG - Intergenic
1050364746 9:4863834-4863856 CTTTGTGTTGGGAGGCTGCTAGG + Intronic
1055785336 9:79864448-79864470 CCTTCTGAAGGGAGGCCGGAAGG - Intergenic
1055829024 9:80358751-80358773 TCTTCTGAAAGGAGGCTGGAAGG + Intergenic
1056019813 9:82430181-82430203 CCTTCTGAAGGGAGGCTGGAAGG + Intergenic
1056506850 9:87265722-87265744 CCTTCAGCAGGGAGCCTGGAAGG - Intergenic
1056575897 9:87856065-87856087 CCATCTGAAGGGAGGCTGGAAGG + Intergenic
1057072025 9:92106849-92106871 CCTTCTGAAGGGAGGCTGGAAGG - Intronic
1057353377 9:94317954-94317976 CCTGCTTTAGGGAGGCTTCTCGG - Intergenic
1057654374 9:96939638-96939660 CCTGCTTTAGGGAGGCTTCTCGG + Intronic
1060196719 9:121628723-121628745 CCTTCTTTAGAGAGGCTCTTTGG + Intronic
1061947335 9:133916097-133916119 CCTTCTGAAGGAAGCCTGGCAGG + Intronic
1061957872 9:133973026-133973048 TCTCCAGGAGGGAGGCTGGTTGG - Intronic
1062445617 9:136592955-136592977 CCATCTGTAGCGAGGCTTCTTGG + Intergenic
1185581161 X:1212577-1212599 CTTTCTGCTGGGAGGCTGGATGG - Exonic
1188068974 X:25695785-25695807 CCCTCTGTGGGGAGGCTTGCAGG + Intergenic
1188081024 X:25840720-25840742 CCTACTGGAGGGTGGATGGTGGG + Intergenic
1189501093 X:41559844-41559866 CCCTCTGGAGGGGGGGTGGTGGG + Exonic
1190310508 X:49113984-49114006 CCTTCTGACAGGACGCTGGTTGG - Intronic
1190497242 X:51038311-51038333 AGTTCTCTAGGCAGGCTGGTGGG + Intergenic
1190508748 X:51155940-51155962 AGTTCTCTAGGCAGGCTGGTGGG - Intergenic
1197177986 X:123504946-123504968 CCTGCTGTAGTGAGGCTAGCTGG - Intergenic
1199093603 X:143716828-143716850 CCTGCTGTAAGCAGGATGGTGGG - Intronic
1199214732 X:145251332-145251354 CCTGCTGTAAGCAGGATGGTGGG + Intronic
1199320569 X:146433280-146433302 CCTTTTGTAGGATGGATGGTGGG + Intergenic
1200060666 X:153482386-153482408 GCTCCTGCAGGGAGGCAGGTAGG - Intronic