ID: 1064894492

View in Genome Browser
Species Human (GRCh38)
Location 10:20219085-20219107
Sequence ATCTAAAAGATAATGGAGGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 369}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064894489_1064894492 -8 Left 1064894489 10:20219070-20219092 CCAAGATAGCACTACATCTAAAA 0: 1
1: 0
2: 1
3: 9
4: 159
Right 1064894492 10:20219085-20219107 ATCTAAAAGATAATGGAGGTAGG 0: 1
1: 0
2: 3
3: 12
4: 369
1064894488_1064894492 2 Left 1064894488 10:20219060-20219082 CCAGATGATACCAAGATAGCACT 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1064894492 10:20219085-20219107 ATCTAAAAGATAATGGAGGTAGG 0: 1
1: 0
2: 3
3: 12
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064894492 Original CRISPR ATCTAAAAGATAATGGAGGT AGG Exonic
901098709 1:6702600-6702622 AGAGAAAAGACAATGGAGGTAGG - Intergenic
901665224 1:10822436-10822458 AAATAAAAGTTAATGCAGGTCGG - Intergenic
902961236 1:19964174-19964196 CTCTAAAAGATAAAGGAGGCAGG + Intergenic
903227661 1:21902845-21902867 AGCTAAAAGGTAAAGGAGGCAGG - Intronic
903574057 1:24326916-24326938 CTCTATGAGATAATGGAAGTTGG + Intronic
904051184 1:27639947-27639969 ATTTAGAAGGTAAGGGAGGTCGG - Intergenic
904513813 1:31037422-31037444 ATCTAAAACATAATGAATTTAGG + Intronic
904560941 1:31396974-31396996 AGCTAGTAGCTAATGGAGGTAGG + Intergenic
905162757 1:36051109-36051131 ATCAAAAAAATAATTGAGGCTGG - Intronic
905162776 1:36051229-36051251 ATGTAAAAGATATTTGAGGCCGG - Intronic
908077121 1:60532334-60532356 ATCTGGAAGATAATAGAGTTAGG - Intergenic
908864930 1:68537130-68537152 ACCTAGAAGATAAAGGAGGGTGG - Intergenic
909071878 1:71004702-71004724 ATCAAAAAGAGAATAGAGATTGG + Intronic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
909574343 1:77157317-77157339 ATCTTAAAAATAAAGGTGGTAGG + Intronic
909969619 1:81966028-81966050 AGGGAAAAGATAAAGGAGGTGGG - Intronic
910786864 1:91008425-91008447 ATCTACAAACAAATGGAGGTAGG + Intronic
910899326 1:92102525-92102547 AGGAAAAAGATAATGGAGATTGG + Exonic
911016754 1:93341615-93341637 GCCTAAATAATAATGGAGGTGGG - Intergenic
911159085 1:94666033-94666055 ATCTAAACAATAATGTATGTTGG + Intergenic
911802661 1:102162848-102162870 ATATGAAAGATAATGGTGGGGGG - Intergenic
912020202 1:105099000-105099022 ATTTTAAAAATAATGGAGGCAGG + Intergenic
912189128 1:107317199-107317221 AGTTAAAATATCATGGAGGTGGG - Intronic
912205713 1:107506804-107506826 ATCTGAAAAATAATGGAGCTAGG - Intergenic
912925599 1:113910464-113910486 ATCTAACAGGTGATGGAGTTAGG - Intronic
916318028 1:163472203-163472225 AGCTAAAAGGTGATGGGGGTGGG + Intergenic
916695155 1:167227795-167227817 ATGTAACAGATAATGAAGATTGG + Intronic
916940666 1:169673799-169673821 ACCTAAAAGTTAATGGTGGGGGG + Intronic
917089701 1:171340655-171340677 ATCTTAAAGATCATGTAGATTGG + Intronic
917130820 1:171741274-171741296 ATCAGAAAGAGAATGGAGGCTGG - Intronic
918225234 1:182475064-182475086 TTCTAAAGTACAATGGAGGTGGG + Intronic
919068151 1:192719662-192719684 ATCTCAAAAATAAAGGAGGAGGG + Intergenic
921045179 1:211471437-211471459 ATCTAAAAGATGAGGGAAATTGG + Intergenic
921167769 1:212519217-212519239 ATCAAAAAGATAAGGAAGGGTGG + Intergenic
922521875 1:226260274-226260296 CTCTAAAACATAACAGAGGTTGG - Intronic
923069539 1:230549911-230549933 CTCTAAAACATGAGGGAGGTGGG - Intergenic
923724026 1:236490978-236491000 ATCTAAAAGAGAAAGGAAGGGGG - Intergenic
924691973 1:246361285-246361307 ATCAAAAAAATAATCGACGTAGG + Intronic
1063593728 10:7413751-7413773 GGATAAAAGAGAATGGAGGTCGG - Intergenic
1063676640 10:8146295-8146317 ATCTCAAAGAAGAGGGAGGTAGG - Intergenic
1063794289 10:9493590-9493612 ATATAAAAGATAAAGGGGGAGGG + Intergenic
1064894492 10:20219085-20219107 ATCTAAAAGATAATGGAGGTAGG + Exonic
1064916935 10:20468723-20468745 AGCTAAAAAATAATGAAGCTGGG + Intergenic
1065577982 10:27143011-27143033 ATAAAAAAGATAATGTAGGCTGG - Intronic
1065773302 10:29097487-29097509 ATTTAAAAGATAAAGGAGAAAGG - Intergenic
1066284836 10:33955476-33955498 ACCTAAAAGAGAGTGGAGGAAGG - Intergenic
1068009125 10:51425935-51425957 ATTTAAAATATAATGGAGAAGGG + Intronic
1068090930 10:52431401-52431423 ATCTAAAGGCAAGTGGAGGTTGG - Intergenic
1068427844 10:56890644-56890666 AAAAAAAAGATAATGGGGGTAGG - Intergenic
1069094716 10:64244645-64244667 ATCTATAAGAAAATGCAGGCCGG - Intergenic
1069405717 10:68095813-68095835 ATGAAAAAGATTCTGGAGGTGGG + Intergenic
1070055071 10:72926402-72926424 AGGTGAAAGATAATGAAGGTGGG - Intronic
1070667022 10:78352197-78352219 ATCTCTTAGATAATGGTGGTTGG + Intergenic
1070916262 10:80157115-80157137 ATCTTAAAGACAATGGAGCTGGG + Intronic
1070997052 10:80794093-80794115 ACAGAGAAGATAATGGAGGTAGG - Intergenic
1071707592 10:88016140-88016162 ATATAAAAGAAAATGAGGGTTGG - Intergenic
1073612307 10:104956652-104956674 AGTTAATAGATGATGGAGGTGGG + Intronic
1075248236 10:120843981-120844003 ACCTTGAAGATAATGGATGTTGG - Intergenic
1078114688 11:8434570-8434592 ATATAAAAAATTCTGGAGGTAGG + Intronic
1079583616 11:22097340-22097362 ATCTGAAAGACAATAGAGTTAGG - Intergenic
1080115760 11:28619935-28619957 ATTCAATAGATAAGGGAGGTAGG - Intergenic
1080243280 11:30151707-30151729 AATGAAAAGTTAATGGAGGTTGG - Intergenic
1080402747 11:31952373-31952395 ATACAAAAGACAGTGGAGGTTGG + Intronic
1080638362 11:34143018-34143040 ATCTGAAAGAGAAGGGAGGGAGG + Intronic
1080882159 11:36332513-36332535 ATTTAGGAGATAATGGATGTAGG - Intronic
1083018267 11:59478946-59478968 ATCTGAAACACAATGGAGTTTGG + Intergenic
1083050024 11:59768763-59768785 ACCAGAGAGATAATGGAGGTGGG + Intronic
1086981949 11:93207722-93207744 ATCTAAAAGGTAATAAAAGTGGG + Intergenic
1086997426 11:93373943-93373965 ATCAAAAAAATAATAGATGTTGG - Intronic
1087702800 11:101455132-101455154 ATTTAAAAGAAAATGTAAGTAGG - Intronic
1087846641 11:102980981-102981003 ATATAAAAGATAATGCAGGTTGG + Intergenic
1087968211 11:104445953-104445975 ATCTAGAAGAAAATTGAGGAAGG - Intergenic
1088272308 11:108046635-108046657 AGCCAAAAAATAATGGTGGTGGG - Intronic
1089035743 11:115388705-115388727 ACCTAAAAAATAAAAGAGGTGGG + Intronic
1090281335 11:125458588-125458610 TTCTGAAAGAAAAGGGAGGTGGG - Intronic
1091367735 11:135036618-135036640 CTCTAAAAGACATTTGAGGTTGG - Intergenic
1093203857 12:16223278-16223300 ATGGGAGAGATAATGGAGGTCGG + Intronic
1093204231 12:16227832-16227854 ATAGGAAAGATATTGGAGGTAGG + Intronic
1093818177 12:23576167-23576189 ATCTGAAATATGATGTAGGTAGG + Intronic
1095324993 12:40878771-40878793 ATCTGAAAGATAAAGAAGTTGGG - Intronic
1095390362 12:41698751-41698773 ATTTGAAATATAATGGAGATAGG + Intergenic
1095521121 12:43067295-43067317 ATATAAAAGACAATGGTGGCTGG + Intergenic
1097307978 12:58090166-58090188 AGCTAATAGAAAATGGAGGGAGG - Intergenic
1097558725 12:61173637-61173659 AGATAAAACATAATGGATGTTGG - Intergenic
1097626620 12:62010044-62010066 ATGTAAAAGCTAATGGAGAATGG - Intronic
1098031826 12:66262921-66262943 ATCTAAAAGAAAGTGGTGTTAGG + Intergenic
1098474347 12:70882974-70882996 ATTTAAAAGATAATGAAGGCTGG + Intronic
1099508169 12:83503843-83503865 ATCCAAAGGCTAATGGAGATTGG + Intergenic
1100051357 12:90452118-90452140 ATTTAAAAGATAATTAAGATTGG + Intergenic
1101310147 12:103570942-103570964 ATTTAACAGATAAAGGAGCTGGG + Intergenic
1101723828 12:107373645-107373667 ATCTATAAGATAGAGGAGCTTGG - Intronic
1102337363 12:112093241-112093263 ATATAAAACATCATGGAGGCCGG + Intronic
1103107024 12:118237408-118237430 CTCTAGAAGTTAATGGAGGGAGG + Intronic
1104201070 12:126589733-126589755 GTCTAAGAGATATTGGATGTAGG + Intergenic
1106507765 13:30386494-30386516 ATTTAAAAGCTAATAGAGGCTGG + Intergenic
1106936061 13:34721597-34721619 ATCAAAAGGATAATTGAGTTGGG - Intergenic
1108068390 13:46602656-46602678 ATTTAAAATAAAATGGAGGCTGG + Intronic
1108119063 13:47163348-47163370 TTTTAAAAGATCAGGGAGGTGGG - Intergenic
1108228084 13:48310423-48310445 ATGTTCAAGATAATGGAGTTCGG - Intronic
1108358321 13:49647394-49647416 ATCTAAAGGATAATGGAGCCAGG + Intergenic
1108416931 13:50207605-50207627 ATCTAAATGATAATCCAGCTGGG - Intronic
1109161384 13:58979125-58979147 ATTTAAAAAATAATGGTGGATGG + Intergenic
1109684500 13:65798185-65798207 ATTTAAAACAGAATGGAGATAGG + Intergenic
1110185860 13:72674134-72674156 GTCTAAGAGATAATGGTGGCAGG - Intergenic
1111007238 13:82263854-82263876 ATCTTAAAGCTAATGCAGTTTGG - Intergenic
1112693568 13:101921587-101921609 ACCCAAAAGATGATGGTGGTAGG - Intronic
1112776264 13:102846622-102846644 ATTTAAAAGATTACGGAAGTGGG - Intronic
1112909299 13:104462130-104462152 ATATGAAAGTTGATGGAGGTCGG - Intergenic
1114502115 14:23178023-23178045 AACTAAAAAATATTGGAGCTAGG - Intronic
1114961511 14:27896482-27896504 AATTAAAAAATAATGGATGTTGG - Intergenic
1118566093 14:67142673-67142695 ATCTAATAGGAAATGGAGGGGGG - Intronic
1120124887 14:80729685-80729707 ATCAAAAAGAAAATAGATGTTGG - Intronic
1122488003 14:102094644-102094666 ATTAAAAAGAAAATGGAGGCTGG + Intronic
1124827754 15:33115564-33115586 ATGTAAAAGATAGGAGAGGTGGG - Intronic
1124932330 15:34133321-34133343 CTATACAAGATAATGGTGGTTGG + Intergenic
1125287052 15:38105075-38105097 AACTAAAAGAAAATGGAAGGAGG - Intergenic
1126191010 15:45878803-45878825 AATTAAAAGATAATAGATGTTGG + Intergenic
1126506521 15:49410654-49410676 AGATAAAAGTTTATGGAGGTGGG - Intronic
1127631579 15:60832657-60832679 ATGAAAAAAAAAATGGAGGTGGG + Intronic
1129161325 15:73749569-73749591 ATCTAAAATAAGATGGAGGCAGG + Intronic
1130772445 15:86938431-86938453 CTCCAAAAGATCAGGGAGGTAGG - Intronic
1130815095 15:87423110-87423132 ATCTTAAAGATTATGGAAGATGG + Intergenic
1131671051 15:94619829-94619851 ATCTGAAAGAGAATTGAGGATGG + Intergenic
1134209976 16:12267936-12267958 GGCTAAAGGATAATGGAGGAGGG - Intronic
1134267386 16:12703843-12703865 ACCAGAAAGATAAAGGAGGTGGG + Intronic
1134878851 16:17726617-17726639 AACTAAAAAATAATAGATGTTGG + Intergenic
1135380425 16:21991694-21991716 AGATAAAAGATAATGGGGCTGGG + Intronic
1138239817 16:55418410-55418432 CTCTAAAAGGGAATGGAGGGAGG + Intronic
1139744079 16:69060312-69060334 ATATAAAAGTGAATGGAGGCTGG - Intronic
1140672837 16:77295751-77295773 ATTTTAAAGAAAATGAAGGTAGG - Intronic
1141916377 16:87100001-87100023 ATCTCAGAGAGAATGGGGGTTGG - Intronic
1143733095 17:8892278-8892300 ATCTGTAAGAAAAAGGAGGTGGG + Intronic
1144015427 17:11190773-11190795 ATCCAAAAGAAAATGGGGGAAGG + Intergenic
1144708399 17:17384799-17384821 ATGTAAAAGATTTTGAAGGTAGG + Intergenic
1150917895 17:69455132-69455154 ATCTCCAATATAATGGAGCTTGG - Intronic
1151111697 17:71685701-71685723 ATCAAAAAAATAATAGATGTTGG - Intergenic
1152788610 17:82265688-82265710 ATCTACAAGATGATGCAGGGAGG - Exonic
1152887008 17:82858455-82858477 ATTTAAAATAAAATGCAGGTTGG + Intronic
1153458575 18:5306629-5306651 ATATAAAATATAATGGGGCTAGG - Intergenic
1155097663 18:22574438-22574460 AGCTATAAGATAATAGAGCTTGG + Intergenic
1155579750 18:27289793-27289815 ATGTAAAATATAATGCAGGACGG - Intergenic
1156160079 18:34349178-34349200 ATCTAAAATAAAATTGAGGTAGG + Intergenic
1156369357 18:36458780-36458802 AATTAAAAGAAAAGGGAGGTGGG - Intronic
1157804048 18:50644911-50644933 TTCTAGAAGAGGATGGAGGTGGG - Intronic
1158923493 18:62223861-62223883 TTTTAAAAGAGAATGGATGTTGG - Intronic
1159746203 18:72238502-72238524 GTGAAAAAGATAAGGGAGGTAGG + Intergenic
1164929222 19:32162084-32162106 ATCTAAAAGATAATTCAGAGCGG + Intergenic
1166630892 19:44406536-44406558 ATTTAAAAAATAATAGATGTTGG + Intergenic
1166819602 19:45569553-45569575 TTCTAAACTCTAATGGAGGTGGG - Intronic
925661067 2:6203275-6203297 TTATAAAAGATAAATGAGGTAGG + Intergenic
925798654 2:7574407-7574429 AGCTAATAAGTAATGGAGGTGGG + Intergenic
925953277 2:8936289-8936311 AACTCAAAGATAAAGGAGATGGG - Intronic
926296134 2:11570111-11570133 CTCTAAAAGATAATGGGGCCAGG + Intronic
926741121 2:16111658-16111680 CTCTGAAAGATATTGGGGGTAGG + Intergenic
926911921 2:17859390-17859412 GTCTAAAAGATAATGGTGCAGGG + Intergenic
927069487 2:19511789-19511811 ATCAAAAAAATAATAGATGTTGG - Intergenic
928018781 2:27684128-27684150 ATTTAAAAGATAATATAGGCCGG + Intronic
928151425 2:28833283-28833305 ATCAAAGAGATAAGGGAGGAGGG - Intronic
928539783 2:32273938-32273960 CTCTAAAAAATAAGTGAGGTCGG + Intergenic
928852330 2:35764423-35764445 ATCTTAAAAATAATTGAGGGAGG + Intergenic
931257793 2:60588895-60588917 AGCTATAAGCTAATGAAGGTTGG - Intergenic
932062427 2:68519969-68519991 ATCAAAAACATAATAGATGTTGG - Intronic
936672778 2:114677912-114677934 ATGTAAAACATATTGGTGGTTGG - Intronic
938542788 2:132299180-132299202 ATTTAAAAAATAATAGATGTTGG - Intergenic
938916702 2:135948566-135948588 ATCTAATAGTTAATGTAGGCTGG + Intronic
939993046 2:148894198-148894220 AGATAGAAGATAATGGAGTTTGG - Intronic
940034283 2:149297086-149297108 ATCAAACAGATATTGTAGGTGGG - Intergenic
942119213 2:172760420-172760442 ATTTAAAAGTGAATGGAGGCTGG + Intronic
944624981 2:201561573-201561595 ATTTAAAAGATAATATAGGCTGG + Intronic
944955663 2:204805518-204805540 TTCTAAAAAATAAAGGAGGAGGG + Intronic
945393597 2:209295227-209295249 ATCAAAAAAATAATAGACGTTGG + Intergenic
946718453 2:222578541-222578563 ATGTAAAAGAAAAAGGAGGCCGG + Intronic
946828066 2:223699262-223699284 ATTTAAAAGAAAATGGGGGCTGG + Intergenic
947108095 2:226689039-226689061 AATTAAAAAATAATGGATGTTGG + Intergenic
947253551 2:228135899-228135921 ATATCAAAGAAAATGTAGGTAGG + Intronic
1169451198 20:5713039-5713061 ATCTAGAGGATAATGGAAGAAGG - Intergenic
1169541997 20:6610093-6610115 TTCTAAAAGATTTTGGAAGTAGG + Intergenic
1170075424 20:12413576-12413598 ATGGAAAAGATAATGGTGTTGGG + Intergenic
1171871664 20:30532017-30532039 ATTTAAAAAATAATAGATGTTGG - Intergenic
1172221770 20:33279094-33279116 ATATTAAAGATAATGGAGTGGGG - Intronic
1175525995 20:59633925-59633947 ATCAAAATGATAATGAAGTTAGG - Intronic
1175824454 20:61929432-61929454 AGTTAAAAGACATTGGAGGTTGG - Intronic
1177073712 21:16545019-16545041 ATTTAAGAGATATTGGATGTAGG - Intergenic
1177211341 21:18075795-18075817 ACCTATAAGATAATGGCGTTAGG + Intronic
1177345896 21:19870289-19870311 AACCAAAAGAGAATTGAGGTGGG + Intergenic
1177400757 21:20602126-20602148 ATCTCACAGATAGTAGAGGTGGG - Intergenic
1178535634 21:33407991-33408013 ATCTGCAAGGTGATGGAGGTGGG + Intronic
1178796567 21:35750357-35750379 ATCTAAAACATAATGCAGGCTGG - Intronic
1179396535 21:41045443-41045465 ATTTAAATGTTAATGAAGGTGGG + Intergenic
1181692836 22:24574828-24574850 ATTCAAAAGATAATGGTGGCCGG - Intronic
1182027304 22:27130424-27130446 ATCTAAGAGATACTGGAGGTGGG - Intergenic
1182207686 22:28645331-28645353 ATCAAAAAGATAATTCAGGCCGG + Intronic
949109386 3:240247-240269 ATTTAAAAAATAGTGGATGTTGG - Intronic
949742107 3:7247728-7247750 ATATAAAACATTATGGAGATGGG - Intronic
949828915 3:8192930-8192952 TTCTATAAAATAATGGAGGAGGG - Intergenic
950333152 3:12173246-12173268 ATCTAGAAGAAATGGGAGGTGGG - Intronic
950423093 3:12910201-12910223 ATATAAAAGATAACTGAGCTGGG + Intronic
951189703 3:19753908-19753930 ATTTAAAAAAAAATGGAAGTGGG + Intergenic
951223919 3:20098548-20098570 ATCTATAAGATGATGAAGCTGGG - Intronic
951263681 3:20541868-20541890 AGATAAAAGATACTGGAGTTTGG - Intergenic
951404586 3:22279938-22279960 AATTAAAAAATAATGGATGTTGG - Intronic
951764559 3:26183274-26183296 ATGTAAAAGATGATGGGAGTTGG - Intergenic
952607106 3:35161627-35161649 TTTAAAAAGATAATGCAGGTTGG + Intergenic
952609669 3:35193027-35193049 ATGTAAAATATAACAGAGGTAGG - Intergenic
952799188 3:37272252-37272274 CTCTAAAAGATAAAGATGGTTGG + Intronic
952926652 3:38325456-38325478 ACCTGCAAGGTAATGGAGGTTGG + Intergenic
952994226 3:38862226-38862248 ATCAAAAAAATAATAGATGTTGG + Intronic
953658652 3:44874119-44874141 ATCTAAAAGAAACTGGTAGTAGG + Intergenic
955512985 3:59699919-59699941 AACTAAAAGATAATGGCAGGAGG - Intergenic
956491714 3:69779464-69779486 ATTTACAGGATAATGGAGGATGG + Intronic
957580445 3:82065790-82065812 ATATAAAAGATAATGGATGTTGG - Intergenic
958924366 3:100141616-100141638 ATCAAAAAGAAGATGAAGGTAGG + Intronic
959008061 3:101043010-101043032 ATATAAAAGATAAGGGAGAGGGG + Intergenic
959363749 3:105429336-105429358 GTCTAAAAGATAAAGGAAGCAGG - Intronic
959791580 3:110368092-110368114 AAGAAAAAGATGATGGAGGTGGG - Intergenic
960459133 3:117911832-117911854 ATCTAATAAGTGATGGAGGTGGG - Intergenic
961224695 3:125232386-125232408 ATGTAAATGATAATAGAGCTGGG - Exonic
961524045 3:127485315-127485337 ATGTTAAAGATAAGGAAGGTGGG - Intergenic
961695580 3:128701823-128701845 ATATATAAGACAAAGGAGGTGGG + Intergenic
962782197 3:138729754-138729776 ACTTAAATGATTATGGAGGTGGG - Intronic
963029187 3:140950510-140950532 AACTAAAAGAAGATGGTGGTAGG - Intronic
963230899 3:142907814-142907836 AGCTAATAGATAATAGAGTTTGG - Intergenic
964697974 3:159531096-159531118 AACTTTATGATAATGGAGGTTGG + Intronic
965060633 3:163780929-163780951 ATCTAAAAAATAATATATGTTGG - Intergenic
966320998 3:178700737-178700759 ATCAAAAAGATATTGGTGATTGG - Intronic
967207961 3:187140617-187140639 ATTTACAGGATAATGCAGGTAGG - Intronic
967535224 3:190594359-190594381 ATCTGAAAGTGAAAGGAGGTGGG - Intronic
968333612 3:197893540-197893562 TTCTAAAAGAAAATGAATGTAGG + Intronic
969215176 4:5716036-5716058 AGCTAGAAGACAATGGAGGCCGG - Intronic
969551966 4:7875618-7875640 CTCAAAAAAAAAATGGAGGTGGG + Intronic
970992333 4:22227139-22227161 ATTTTAAAGACAATGAAGGTCGG + Intergenic
971921725 4:32949134-32949156 ATCAAAAAAATAATAGATGTTGG + Intergenic
972214377 4:36878823-36878845 ATCTAGAAAATTATGGAGCTTGG - Intergenic
973618359 4:52703157-52703179 AACAAAAAGATAATGGGGGAAGG - Intergenic
973663907 4:53138103-53138125 ATCAAAATCATAATGGTGGTGGG + Intronic
974028113 4:56751923-56751945 ATCAAAAAGAGAATGGAGGACGG + Intergenic
974071267 4:57126429-57126451 ATCTAAAATACAATGGGGGCTGG - Intergenic
975644837 4:76535946-76535968 AATTGAAAGATAATGGATGTAGG + Intronic
975882308 4:78924906-78924928 ATCTAAAAAATATAGGAGTTAGG - Intronic
976391378 4:84508066-84508088 ATCAAAAAGAAAATGCATGTGGG - Intergenic
976683499 4:87784953-87784975 GTCAAAAAAATAATGGAGGAGGG - Intergenic
976750614 4:88448413-88448435 TTCTAAAAGATAAAAGAGGCTGG - Intergenic
979144935 4:117234793-117234815 ATCCAATATATAAAGGAGGTTGG + Intergenic
979906733 4:126302683-126302705 CTCTACAAGAAAATGGAGTTTGG - Intergenic
980069684 4:128230379-128230401 TCCTATAAGATAATGGAGCTGGG + Intergenic
980170722 4:129286507-129286529 ATCTTAAACATAATAGAGGATGG - Intergenic
980186657 4:129470336-129470358 ATCAAAAAAATAATAGATGTTGG - Intergenic
980287679 4:130801957-130801979 TTCCAAAAGATAAAGGAGGAAGG - Intergenic
980791329 4:137623312-137623334 GTGTAAAATAAAATGGAGGTAGG - Intergenic
981228172 4:142321120-142321142 ATCAAAAAAATAATAGATGTTGG - Intronic
981680733 4:147394865-147394887 AACTAAAACATAATAGATGTTGG + Intergenic
981923510 4:150113106-150113128 ATCAAAAAGATAATTCAGGCTGG - Intronic
981948182 4:150374534-150374556 ATATAAATGATACTGCAGGTTGG + Intronic
982455229 4:155601954-155601976 ATCAAAAAAATAATAGATGTTGG - Intergenic
983384093 4:167035936-167035958 TTCTAAAAGATAAGGGAAATGGG - Intronic
983398154 4:167229553-167229575 ATTTAAGAGATAATGGATGATGG - Intronic
984064457 4:175031105-175031127 AACTAAAAGATAAAGAAGGCTGG + Intergenic
985050414 4:185985545-185985567 TTGTAAAATATAATGGAGGCTGG - Intergenic
986481711 5:8196043-8196065 AGTTAAAAGATAGGGGAGGTTGG - Intergenic
987288259 5:16481971-16481993 TTCTAAAAGATACAGGAGGAAGG + Intronic
988081789 5:26424593-26424615 CTCTAAAAGACAATGGAGAAGGG - Intergenic
988917470 5:35909218-35909240 AGATAAAAGTTAATGGAGATGGG + Intronic
989362932 5:40624026-40624048 ATCTTAAAGTTAATGGAGAATGG - Intergenic
989558354 5:42823044-42823066 AGCTAAAAGATAGAGGAGCTGGG + Intronic
989782683 5:45288253-45288275 ATTTAAAAAGAAATGGAGGTAGG - Intronic
990758060 5:59098044-59098066 ATTTAAAAAATATTGGAAGTTGG - Intronic
990967138 5:61461316-61461338 TTCTAAAAAATTATGGAGGGAGG - Intronic
990998098 5:61753542-61753564 ATTTAATAAAAAATGGAGGTGGG + Intergenic
991635348 5:68699047-68699069 GTGTAAAAGATAAAGAAGGTAGG + Intergenic
992661486 5:78966185-78966207 ATTTAAAAGATAATACAGATAGG + Intronic
993169838 5:84404615-84404637 CTCTAGAAGATAATGTATGTGGG + Intergenic
993359294 5:86954022-86954044 ATCTAAGAGTTAGTTGAGGTTGG + Intergenic
994555384 5:101293395-101293417 ATGTAAAAGATAATATAGTTAGG + Intergenic
994680627 5:102882376-102882398 ATCTATAAAATAATAGATGTTGG - Intronic
994729739 5:103477498-103477520 CTCTAAAAGTAAATGGAGATAGG - Intergenic
996694565 5:126379558-126379580 ATCAAAAAAATAATAGATGTTGG - Intronic
996767057 5:127045096-127045118 AACTAAAAGAAAATTGTGGTGGG - Exonic
996945279 5:129059241-129059263 TTCTAAAAAATAAAGGAGGGGGG + Intergenic
999283658 5:150381209-150381231 ATCTAAGAGGTTATGGAGCTTGG - Intronic
999818071 5:155197790-155197812 TTCTAAATGATAGTGGAGATGGG - Intergenic
1002847096 6:956421-956443 ATCAAAAAGATAATCAAGGCTGG + Intergenic
1004034925 6:11914519-11914541 ATCTAAAAGATAGTGTATATAGG + Intergenic
1004625399 6:17371372-17371394 ATTTAAAAAATAATAGATGTTGG - Intergenic
1005298867 6:24451722-24451744 ACCTAATAAATAATGGACGTGGG - Intronic
1008074200 6:47128886-47128908 ATCAAAAACATAATGAAGGCCGG + Intergenic
1008287272 6:49669272-49669294 CTATAAAAGATGATGGGGGTTGG - Intergenic
1008843282 6:55930386-55930408 GTTTAAAAAGTAATGGAGGTTGG - Intergenic
1008956972 6:57226344-57226366 ATCTGAAAGATAAATGAGTTTGG + Intergenic
1009301061 6:62021249-62021271 GTCTAAAAGAGGATGGAGGGTGG + Intronic
1011591339 6:88973156-88973178 TTCAAAGAGATAGTGGAGGTGGG - Intergenic
1012489808 6:99769856-99769878 ATCTGACTGATAATGGATGTGGG - Intergenic
1012857903 6:104525049-104525071 TCCTTAAAGATAATGGAAGTGGG - Intergenic
1014444255 6:121507875-121507897 ATCAAAATGATAATAGAGGCTGG - Intergenic
1014840945 6:126219292-126219314 ATCTAAAGGACAATGGAGGAGGG - Intergenic
1014860200 6:126457031-126457053 ATCAAAAAAATAATGGATGCTGG + Intergenic
1014866908 6:126543617-126543639 ATAAAACAGATACTGGAGGTTGG + Intergenic
1015232129 6:130927266-130927288 AAATACAAGATAATGGAAGTGGG + Intronic
1015759030 6:136637564-136637586 TTCAAAAAGAAAATGCAGGTTGG + Intronic
1017413298 6:154192854-154192876 AACTAAAAAATAATAGATGTTGG + Intronic
1017419164 6:154255301-154255323 AACTGAATGATAATTGAGGTGGG + Intronic
1017562919 6:155649874-155649896 ATTTAAAAGATGATGGATTTTGG - Intergenic
1017655707 6:156627272-156627294 AATAAAAAGAGAATGGAGGTGGG - Intergenic
1017954310 6:159166157-159166179 ATCTTAAAGAAAATGGAACTCGG - Intergenic
1018347886 6:162921643-162921665 AACTAAAAGTAAATGGGGGTAGG - Intronic
1020714098 7:11648211-11648233 CTCTAAAGGATAATGGTGGAGGG - Intronic
1020995728 7:15261607-15261629 ATCTAAAAGATAAAGAAAGAGGG + Intronic
1022262466 7:28719678-28719700 AGCTAATAGGTGATGGAGGTAGG + Intronic
1022998084 7:35779088-35779110 ATTTGAAAGATAATGGTGGAAGG + Intergenic
1024129527 7:46336464-46336486 ATCTGAAAGTGAAAGGAGGTGGG - Intergenic
1025172219 7:56769843-56769865 ATCAAAAAGAGAATGAAGGCTGG + Intergenic
1025699646 7:63805712-63805734 ATCAAAAAGAAAATGAAGGCTGG - Intergenic
1025924937 7:65950627-65950649 AGCAAAAAAAAAATGGAGGTAGG + Intronic
1027181668 7:75944989-75945011 ATTTAAAAAATAATGGCGGCCGG + Intronic
1027442291 7:78232209-78232231 CACTAAAATATAATGCAGGTAGG + Intronic
1028002964 7:85524432-85524454 AGTTAAAAAATAATGGAGGCTGG - Intergenic
1028404640 7:90462274-90462296 ATCTAAAATATAAGGGAGCCAGG - Intronic
1030573419 7:111255680-111255702 ATCTGAAAGATAAAAGAGCTAGG + Intronic
1030756936 7:113297438-113297460 ATATAATAGATAATAGAGGCTGG + Intergenic
1030760056 7:113339086-113339108 TTCTAAAAGTTAATGCAGGCCGG - Intergenic
1030985671 7:116238899-116238921 ACCTGAAAAATAATGGATGTTGG - Intronic
1033146703 7:138877141-138877163 AAGTAAAAATTAATGGAGGTGGG - Intronic
1034160310 7:148989420-148989442 ATCAAAAAAATAATAGATGTTGG + Intergenic
1035630071 8:1100600-1100622 CTCTATAAGAAAATGAAGGTAGG + Intergenic
1036171122 8:6486019-6486041 ATTTAAAAGTTAAAGGAGGGGGG - Intronic
1038147994 8:24915435-24915457 ATTTAAAAGAAAAAGGGGGTGGG + Intronic
1038297048 8:26303137-26303159 ATCTAAAAGAACAGGGAGGGAGG - Intronic
1038692719 8:29777673-29777695 ATGTGAAAGATAATGGAGAGAGG - Intergenic
1039377299 8:37048303-37048325 AGCTATAAGAAAATGTAGGTAGG - Intergenic
1039726189 8:40219261-40219283 ATCTCAAAAATAATTGAGATGGG - Intergenic
1039968764 8:42303904-42303926 AGCCAAAAGATAAGAGAGGTGGG - Intronic
1040525738 8:48223115-48223137 ATCAAAAAAATAATAGATGTTGG - Intergenic
1041690820 8:60685239-60685261 AACCAAAAGATATTGGACGTGGG + Intronic
1041994046 8:64030430-64030452 ATCTAAAAGAAAATCAAGCTGGG + Intergenic
1042592791 8:70413918-70413940 ATCTAAAAGGGCATGGGGGTGGG - Intergenic
1043000630 8:74755767-74755789 AGATAAAAGATAATGGAACTAGG + Intronic
1043867695 8:85394737-85394759 ATCTGAAAGACGAAGGAGGTGGG - Intronic
1045735524 8:105292167-105292189 ATCCAAAAGAAAATAGATGTGGG + Intronic
1046293269 8:112190048-112190070 ATTTAAAAGATTTTAGAGGTTGG + Intergenic
1046591862 8:116216349-116216371 ATTTAAAAGATAAGGGGGGCTGG - Intergenic
1047819960 8:128508135-128508157 ATTTAAAAGATGTTGGAAGTTGG - Intergenic
1047837873 8:128714337-128714359 ATGTAAAAAACAATGGAGGGAGG + Intergenic
1047988096 8:130257788-130257810 TTCTAAAAAATAATGGGGGGGGG - Intronic
1048119721 8:131565637-131565659 ATCTATGAGATAAAGAAGGTGGG - Intergenic
1048278048 8:133082203-133082225 ATAGAAAAGATAAGGAAGGTTGG - Intronic
1048937228 8:139367320-139367342 CTCTAAAAGTTAAAGGAGGATGG + Intergenic
1050786882 9:9414597-9414619 ATCTAAGAGATGATGAAGATGGG - Intronic
1051160515 9:14202365-14202387 TTCTGAAAGATAATGGAAGTCGG - Intronic
1051216650 9:14804679-14804701 AGATACAAGACAATGGAGGTAGG + Intronic
1051710444 9:19925924-19925946 ATCTGCAGGTTAATGGAGGTTGG - Intergenic
1052761562 9:32597382-32597404 AAATAAAAAATCATGGAGGTAGG + Intergenic
1053396944 9:37784252-37784274 GCCTAAGAGATAATGGAGTTTGG - Intronic
1055029482 9:71759168-71759190 ATCAAATAGATAAAGCAGGTAGG - Intronic
1055142301 9:72889440-72889462 ATCTGAATGGTGATGGAGGTGGG - Intergenic
1056828936 9:89898702-89898724 TTATAAAAGATAATACAGGTCGG - Intergenic
1057918883 9:99080326-99080348 ATTTAAAAGACTATGGAGGCCGG + Intergenic
1058095587 9:100856665-100856687 ATCTCACCTATAATGGAGGTGGG + Intergenic
1058234027 9:102466871-102466893 ATCAAAAAAATAATAGATGTTGG + Intergenic
1186199682 X:7144551-7144573 CCCTAAAAGGTCATGGAGGTAGG - Intronic
1187345822 X:18462725-18462747 AACTAAAAGATACTGGAGGCCGG + Intronic
1187676319 X:21720016-21720038 ATCTAAAAAATGAAGGGGGTAGG + Intronic
1188232721 X:27685208-27685230 ATGTAAAAAATAATCGAGGTGGG + Intronic
1188253993 X:27936733-27936755 ATTTAAAAGATAAGGTAGGCGGG - Intergenic
1188613964 X:32134389-32134411 AACAAACAGATAATGGAAGTGGG + Intronic
1188729490 X:33629773-33629795 ATCTAAAAGTGACTGGAGGCTGG - Intergenic
1188840332 X:35009451-35009473 ATATAAAAGATATTTGAGATAGG + Intergenic
1189146099 X:38656535-38656557 TGCCAAAAGATAAAGGAGGTGGG + Intronic
1189733510 X:44046387-44046409 ATTAAAAAAATAATGGATGTTGG - Intergenic
1189824443 X:44902686-44902708 ATATAAAAGATAATGTAAATAGG - Intronic
1190300232 X:49053231-49053253 ATTTGGAGGATAATGGAGGTTGG + Intergenic
1190967490 X:55314524-55314546 AACCAAAAGATAATAGATGTTGG - Intergenic
1191100791 X:56725171-56725193 ATCAAAAAAATAATAGACGTTGG + Intergenic
1192249300 X:69397716-69397738 ATGGAATAAATAATGGAGGTGGG - Intergenic
1192746377 X:73943077-73943099 ATCTAAAAGAAGAGGGAGGCTGG + Intergenic
1194410345 X:93550076-93550098 ATTTAAAAGATAATGTTAGTTGG - Intergenic
1195693500 X:107649085-107649107 GTCTAAAAAAAAATGGTGGTAGG - Intronic
1196047492 X:111271437-111271459 ATGTAAGAGATAAGGGGGGTTGG + Intergenic
1197611655 X:128645748-128645770 ATCAAAAATATAATAGATGTTGG - Intergenic
1198113826 X:133525767-133525789 AACAAAAACATACTGGAGGTGGG + Intergenic
1198150699 X:133905805-133905827 ATTTAAAACAAAATGGAGGGTGG + Intronic
1198793161 X:140367758-140367780 AGTTAAGAGATGATGGAGGTTGG - Intergenic
1199453226 X:147996987-147997009 ATATGAAAAATAATGGAGGAGGG + Intronic
1199627346 X:149752646-149752668 ATCCAAAGGCTAATGGAGATTGG - Intergenic
1201184354 Y:11384692-11384714 ATCAAAAAGATAATATAGTTAGG + Intergenic
1201852033 Y:18495608-18495630 ATTAAAAAGATAAAGGAGCTGGG - Intergenic
1201881288 Y:18824772-18824794 ATTAAAAAGATAAAGGAGCTGGG + Intronic