ID: 1064896212

View in Genome Browser
Species Human (GRCh38)
Location 10:20240075-20240097
Sequence ACTTGAGGATAGAGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1356
Summary {0: 1, 1: 1, 2: 21, 3: 200, 4: 1133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064896212 Original CRISPR ACTTGAGGATAGAGGGAGGC AGG (reversed) Intronic
900461342 1:2803439-2803461 ACTTGAGGCTAGCGGGGGGCGGG + Intergenic
900806848 1:4773202-4773224 ACTTGAAGAAAGGAGGAGGCTGG + Intronic
901201659 1:7470664-7470686 ATTGGAGGAAAGAGGGAGGAAGG + Intronic
901748003 1:11387431-11387453 ACATGGGGCCAGAGGGAGGCAGG - Intergenic
902388511 1:16089354-16089376 GCTGGAGGCTAGAGGGAGGTGGG + Intergenic
903034094 1:20483908-20483930 GCTGGAGGATAGAGGGTGGTGGG - Intronic
903372171 1:22843491-22843513 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
904232997 1:29092697-29092719 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
904999260 1:34655593-34655615 GATTGAGGGTAGAGAGAGGCAGG + Intergenic
905048966 1:35032009-35032031 AATTGAGGAAAGAGGAATGCTGG - Intergenic
905105043 1:35559019-35559041 AGTGGAGGATGGAGGGAGGGAGG - Intronic
905312925 1:37063084-37063106 ACTGGAGGTGAGAGGGAGGAAGG - Intergenic
906532968 1:46533861-46533883 AAGTGAGGAGAGAGGGAGGATGG - Intergenic
907425438 1:54376277-54376299 ACTTGAGGAAAGGGGTAGGGTGG - Intronic
907455922 1:54575406-54575428 CCTTGGGGGTGGAGGGAGGCAGG + Intronic
907770217 1:57454500-57454522 ACTTGAGGATGGAGGGTGGGAGG + Intronic
908080679 1:60574776-60574798 ACCTGAGGATGGAGGGTGGGAGG - Intergenic
908083068 1:60601027-60601049 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
908393526 1:63704594-63704616 ACCTGAGGAAGGAGGAAGGCAGG - Intergenic
908740352 1:67321038-67321060 ACTTGTGGACGGCGGGAGGCAGG - Intronic
908981328 1:69962819-69962841 ACTGGAGGACAGAGGGTGGGAGG + Intronic
909060671 1:70875618-70875640 ACTTGAGGCTGGAGGGTGGGAGG - Intronic
909102005 1:71359443-71359465 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
909137393 1:71818527-71818549 ACTTGAGGATGGAGGTTGGGAGG + Intronic
909181055 1:72424615-72424637 ACTTGAGGGTAGAAGGAAGAAGG + Intergenic
909289511 1:73864599-73864621 ACTTGAGGCTGGAGGGTGACAGG + Intergenic
909373273 1:74912545-74912567 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
909516444 1:76512700-76512722 AAGGGAGGATAGAGAGAGGCTGG - Intronic
909877008 1:80819125-80819147 CATTGAGGAGAGAGGGAGGAAGG - Intergenic
910139755 1:84014067-84014089 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
910154501 1:84199298-84199320 ACTTGAGGGTGGAGGTAGGGAGG - Intronic
910166349 1:84331882-84331904 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
910370492 1:86510437-86510459 ACTTGAGGATGGAGGGTGGGAGG + Intergenic
910731625 1:90403963-90403985 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
910736297 1:90461596-90461618 ACTTGAGGGCAGAGGGAGGGAGG - Intergenic
910909791 1:92221326-92221348 ACTAGAGGGGAGAGGGAGGAAGG + Intronic
911001878 1:93174636-93174658 ACTTGAGGAGGGAGGGTGGAAGG - Intronic
911149857 1:94587741-94587763 ACCTGATGATAGAGGGAAACTGG + Intergenic
911314339 1:96338026-96338048 ACTTGAGGATGGAGGGTGAGAGG + Intergenic
911491861 1:98579232-98579254 ACTTGAGGGTGGAGGGTGGAAGG - Intergenic
911543931 1:99192710-99192732 ACTTGAGGGTAGAGGGTGGAAGG + Intergenic
911624418 1:100104760-100104782 ACCTGAGAAAAAAGGGAGGCTGG - Intronic
911892085 1:103384195-103384217 ACTTGAGGATGGAGGGTTGGAGG - Intergenic
911895178 1:103424689-103424711 ACTCCAGGAGAGAGGGAGTCAGG - Intergenic
912326079 1:108764031-108764053 ACTTGAGGGTAGAGGGTGGGAGG - Intronic
912890976 1:113530442-113530464 ATTTGAGGGTAGAGGGTGGGAGG + Intronic
913649376 1:120897179-120897201 ACTCGAGGGTAGAAGGAGGGAGG - Intergenic
914077315 1:144366332-144366354 ACTCGAGGGTAGAAGGAGGGAGG + Intergenic
914101863 1:144600173-144600195 ACTCGAGGGTAGAAGGAGGGAGG - Intergenic
914171765 1:145231916-145231938 ACTCGAGGGTAGAAGGAGGGAGG + Intergenic
914297097 1:146337339-146337361 ACTCGAGGGTAGAAGGAGGGAGG + Intergenic
914526872 1:148475877-148475899 ACTCGAGGGTAGAAGGAGGGAGG + Intergenic
914639529 1:149591258-149591280 ACTCGAGGGTAGAAGGAGGGAGG - Intergenic
915005725 1:152634046-152634068 ACTTGAGGTTGGAGGGTGGGAGG + Intergenic
915946644 1:160157333-160157355 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
916347884 1:163814727-163814749 ACTTGGGGAAAGAGCGAGGGAGG - Intergenic
916708373 1:167377815-167377837 ACTTGAGGGTAGAGGGTGGGAGG - Intronic
916940642 1:169673651-169673673 ACTTGAGAATAGAGGGTGGGAGG + Intronic
916967303 1:169963097-169963119 ACTTAAGGGTAGAGGGTGGGAGG - Intronic
917007707 1:170433557-170433579 ACTTGAGGATGGAGGGTGAGAGG + Intergenic
917469527 1:175314529-175314551 ACTTCAGGGTTGAGGGAGCCAGG + Intergenic
917585216 1:176419270-176419292 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
918024416 1:180728989-180729011 ACTTGAGGGTGGAGGGTGGCAGG - Intronic
918272566 1:182916885-182916907 ACTTGAAGGTAGAGGGTGGGAGG + Intronic
918747887 1:188229020-188229042 ACTGGAGGATAAATGGAGGTGGG + Intergenic
918825495 1:189318285-189318307 TCTTGAGAAAAGAGGAAGGCTGG + Intergenic
919035128 1:192297008-192297030 ACTTGAAGATAGAGGATGGGAGG - Intergenic
919138841 1:193544609-193544631 ACTGAAGGAAACAGGGAGGCTGG + Intergenic
919142253 1:193587268-193587290 ACTTGAGGATGGAGGGTGAAAGG + Intergenic
919327433 1:196126436-196126458 ACTTGAGGGTAGAGAGTGGAAGG - Intergenic
919359906 1:196579319-196579341 ACTTGAGGATGGAGGGTCGGGGG + Intronic
919559978 1:199105374-199105396 ACTTGAGGGTGGAGGGTGACAGG - Intergenic
921030622 1:211332459-211332481 CCTGGAGGATGGAGGGAGGTGGG + Intronic
921335362 1:214080173-214080195 ACCAGAGGGTAGAGGGTGGCAGG - Intergenic
921370707 1:214419942-214419964 TTTTGAGGATAGAGGGATGGAGG - Intronic
921372258 1:214436239-214436261 ACTTGAGGATGGAGGGTGAGAGG + Intronic
922163536 1:223096324-223096346 ACTTGAGGGTAGAAGGTGGGAGG - Intergenic
922219100 1:223544182-223544204 ACCTGAGGGCAGAGGGAGCCTGG + Exonic
922544532 1:226446025-226446047 ACTTGGAGAGAGAGGGAGGAAGG - Intergenic
923064145 1:230502815-230502837 ACTAGAGAATGGAGGGAGGGGGG - Intergenic
923189547 1:231607239-231607261 ACTTGAGGGTGGAGGGTGGGTGG - Intronic
923255391 1:232217510-232217532 AGATGTGGATTGAGGGAGGCAGG - Intergenic
923822036 1:237455413-237455435 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
923968408 1:239170759-239170781 ACTTGAGGATGGAGGGTGAGAGG + Intergenic
924212967 1:241789728-241789750 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
924329981 1:242931841-242931863 ACTTGAGGATGGAGGGTGGGAGG - Intergenic
924797015 1:247300030-247300052 ACTAGAGGAAAGAAGAAGGCAGG - Exonic
924805348 1:247357318-247357340 ACTTAAGCATAGAAGGAGGCGGG - Intergenic
924918937 1:248605415-248605437 ACTAGAGGATGGAGGGTGGGAGG - Intergenic
1062991966 10:1827773-1827795 ACTTGATGGTGGAGGGAGGGTGG + Intergenic
1063269963 10:4497296-4497318 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
1064033157 10:11895617-11895639 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1064102363 10:12474743-12474765 GCTTGAGGGTAGAGGGTGGGAGG - Intronic
1064621318 10:17220405-17220427 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1064772410 10:18737155-18737177 ACTTGAAGGTAGAGGGTGGGAGG + Intergenic
1064896212 10:20240075-20240097 ACTTGAGGATAGAGGGAGGCAGG - Intronic
1064999733 10:21327657-21327679 ACAGGAGGAAAGAGGGAGGGTGG - Intergenic
1065059828 10:21888771-21888793 ACTTGAGGTTGGAGGGTGGGAGG + Intronic
1065096058 10:22281977-22281999 ACTTGAGGATGGACGGAGGGAGG + Intergenic
1065201759 10:23319151-23319173 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1065368364 10:24956285-24956307 ACTTGAGGGTGGAGGGCGGGAGG - Intergenic
1065428321 10:25628653-25628675 ACTTGAGGGTGGAGGGAGAAGGG - Intergenic
1065445833 10:25797616-25797638 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1065602140 10:27379900-27379922 ACTAGAGGGTGGAGGGAGGTGGG - Intergenic
1065652978 10:27913277-27913299 ACTTGAAGATGGAGGGTGGGAGG - Intronic
1065822226 10:29536249-29536271 ACTTGAGGGAGGAGAGAGGCAGG + Intronic
1065860417 10:29867876-29867898 ACTTGAGGGTAGAGGATGGGAGG - Intergenic
1065980327 10:30888524-30888546 ACTTGAGGGTAGAGGGTGGAGGG - Intronic
1066136700 10:32454415-32454437 ACTAGAGGTGGGAGGGAGGCGGG + Intronic
1066218095 10:33308206-33308228 ACTTGAGGATGGAGGGTGGGAGG + Intronic
1066462696 10:35625441-35625463 ACTTGAGGATGGAGGGTAGGAGG - Intergenic
1067162647 10:43840372-43840394 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1067328592 10:45293181-45293203 ACCTGAGCACAGAGGGAAGCAGG + Intergenic
1067915363 10:50392027-50392049 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1068086578 10:52381090-52381112 ACTTGAGGGTAGAAGGTGGGAGG - Intergenic
1068087796 10:52396368-52396390 AGTTGATGATAGAGGGAGAAGGG - Intergenic
1068474009 10:57502127-57502149 ACTGGGGAAAAGAGGGAGGCTGG - Intergenic
1068557663 10:58477249-58477271 ACTGGAGAAAGGAGGGAGGCTGG - Intergenic
1069052290 10:63808851-63808873 ACTTGAGGATGGAGGGTGGCAGG - Intergenic
1069964379 10:72101981-72102003 CCTTGAGGGTGGAGGGAGGGAGG + Intronic
1070123435 10:73600579-73600601 ACTTGAGGATAGAAGGTGGAAGG + Intronic
1070871128 10:79754453-79754475 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1070920892 10:80185549-80185571 ATTTGAGGATAGAGTTAAGCAGG - Intronic
1071109030 10:82133406-82133428 ACTTGAGGGTGCAGGGTGGCAGG - Intronic
1071214796 10:83388285-83388307 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1071343550 10:84669936-84669958 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1071367985 10:84920361-84920383 ACTTGAGGGCAGAGGGTGGGAGG + Intergenic
1071418979 10:85470061-85470083 ACTTCAGGGTAGAGGGTGGGAGG + Intergenic
1071638062 10:87276661-87276683 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1071657182 10:87461291-87461313 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1072786735 10:98288396-98288418 ACTTGAGGGTGGAAGGAGGAGGG + Intergenic
1072839794 10:98759180-98759202 ACTTGAGGGTAGAGTGTGGGAGG + Intronic
1072903807 10:99432058-99432080 ACTTGAGGCTAGAGGGTGGGAGG - Intergenic
1073412071 10:103350731-103350753 CGTTGAGGCTGGAGGGAGGCCGG - Exonic
1073832297 10:107399146-107399168 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1073863731 10:107776544-107776566 ACTTGAGGGTAGAGGATGGGAGG + Intergenic
1073981197 10:109155718-109155740 AATTGAGGAAAGAGAGAAGCAGG - Intergenic
1074794656 10:116930382-116930404 ACTTGATGATGGAGGGTGGGAGG - Intronic
1075170527 10:120109447-120109469 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1075278463 10:121117451-121117473 ACTTAAGGATAGAGGGTAGAAGG + Intergenic
1075300739 10:121321835-121321857 AGGTGAGGATAGAGGCAGGTGGG - Intergenic
1075333051 10:121588236-121588258 ACTTGAGGGTGGAGGGTGGGTGG + Intronic
1075543429 10:123335298-123335320 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1075570182 10:123536101-123536123 ACTCCAGACTAGAGGGAGGCTGG + Intergenic
1075642915 10:124077832-124077854 AGTTGAGCACAGAGGGAGGCAGG + Intronic
1075962427 10:126580884-126580906 ACTTATGGGTAGAGGGAGGGAGG - Intronic
1076163381 10:128263191-128263213 ACGTGAGGGTAGAGGAAGACCGG - Intergenic
1076225898 10:128775194-128775216 ACTTGAGATTAGAAGCAGGCAGG + Intergenic
1076293015 10:129362040-129362062 ACCTGGGGAGAGAAGGAGGCAGG + Intergenic
1076597392 10:131632567-131632589 ACTTGAGGGTGGAGGGTGGAAGG + Intergenic
1077242943 11:1520565-1520587 CCGTGAGGATGGAGGGAGCCCGG - Intergenic
1077259211 11:1606806-1606828 ACGTGAGGATATAGGGATGGCGG + Intergenic
1077337225 11:2010828-2010850 ACATGGGGAGGGAGGGAGGCAGG - Intergenic
1077671584 11:4162620-4162642 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1078370563 11:10741173-10741195 ACTTGAGGGTTGAGGGTGGGAGG + Intergenic
1078380632 11:10836902-10836924 ACTTGAGGATGGAAGGTGGGAGG - Intronic
1078380786 11:10838408-10838430 ACTTGAGGATGGAAGGTGGAAGG - Intronic
1078395569 11:10978794-10978816 ACTTGAGGGTAGAGGCAGGGAGG + Intergenic
1078630219 11:12995846-12995868 ATTTGAGGGTAGAGGGTGGAAGG - Intergenic
1079109910 11:17599568-17599590 ACTTGGGGAAGAAGGGAGGCTGG + Intronic
1079285419 11:19126272-19126294 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1079668901 11:23141558-23141580 ACTTGAGGATGGACGGTGGGAGG + Intergenic
1079728451 11:23907609-23907631 ACTTGAGGGCAGAGGGTGGGAGG + Intergenic
1079823893 11:25166170-25166192 ACTTGAGGGTGGAGGGTGGAAGG - Intergenic
1079920768 11:26431551-26431573 ATTTGAGGGTGGAGGGTGGCAGG - Intronic
1080249219 11:30214186-30214208 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1080777377 11:35398506-35398528 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1080804336 11:35638489-35638511 ATTTGAGGAGAGGGAGAGGCAGG + Intergenic
1080853422 11:36091052-36091074 TCTAGAGGATAGAGGGCGCCTGG - Intronic
1081489490 11:43556554-43556576 AGGTGAGGGTAGAGGGAGGGAGG - Intronic
1082001180 11:47394510-47394532 ACTGCAGGAAAGAGGAAGGCGGG + Intergenic
1082264792 11:50107072-50107094 AGTTGAGGCTACAGGGAGGTAGG - Intergenic
1082637841 11:55618365-55618387 ATCTGAGGATGGAGGGTGGCAGG - Intergenic
1082783982 11:57306805-57306827 AGTTTAGGATGGAGGGAGGTGGG - Intronic
1082981455 11:59127229-59127251 ACTTGAGGGTGGAGGGTGGGAGG + Exonic
1083408740 11:62477353-62477375 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1083677766 11:64336549-64336571 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1083922960 11:65790265-65790287 ACCTGAGGACAGACTGAGGCTGG + Intronic
1084390832 11:68875661-68875683 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1084568459 11:69944820-69944842 CCTGGAGGAAGGAGGGAGGCGGG - Intergenic
1084800346 11:71539460-71539482 ACATGAGGATATAGGGATGGCGG - Intronic
1085232088 11:74981012-74981034 ACTTGGGCATAGAGGGATTCAGG + Intergenic
1085787596 11:79468758-79468780 ACTTGAGGGTGGAGGGAGGGAGG + Intergenic
1085790054 11:79489452-79489474 ACTTGAGGGTGGAGGGAGGGAGG - Intergenic
1085828377 11:79872766-79872788 ACGTGAGAATGGAGGGAGGCAGG + Intergenic
1085914225 11:80865505-80865527 ACTTGAGGGTAGAAGGTGGGAGG + Intergenic
1086381329 11:86258092-86258114 ACTGGAGGGTAGAGGGTGGGAGG - Intronic
1086526399 11:87732234-87732256 ACTTGAGGGTGGAGGGTGGGGGG - Intergenic
1086664192 11:89459292-89459314 ACTTGAGGGTAGAGGGTGGGAGG + Intronic
1086731830 11:90259561-90259583 ATTTGAGGATGAAGGGAGGAAGG + Intergenic
1086822291 11:91448654-91448676 ACTTGAGGTTGGAGGGTGGAAGG + Intergenic
1087360382 11:97151272-97151294 ACTTGAAGGTGGAGGGAGGGAGG - Intergenic
1087440364 11:98176230-98176252 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1087657062 11:100937172-100937194 ACTTGATGATAGAGGAACACTGG + Intronic
1087959068 11:104325665-104325687 ACTTGAGGATGGAGAGTGGGAGG + Intergenic
1087978090 11:104575404-104575426 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
1088338837 11:108740132-108740154 ACTTGAGGGTAGAGACAGGAAGG - Intronic
1088409270 11:109515309-109515331 ACTTGAGGGTGGAGGGAAGTAGG - Intergenic
1088442426 11:109886205-109886227 ACTTGAGGGTAAAGGGTGGGAGG + Intergenic
1089033189 11:115355460-115355482 ACTTGAGGGTAGAGGCTGGGAGG + Intronic
1089155334 11:116397708-116397730 AGTTGAGGAGGGAGGGAGGGAGG + Intergenic
1089884897 11:121810769-121810791 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1090591430 11:128274356-128274378 ACTGGAGGGTAGAGGGTGGGAGG - Intergenic
1091042457 11:132294608-132294630 AGTTGAGGACAGGAGGAGGCAGG + Intronic
1091132946 11:133161898-133161920 ACTGGAGGGTACCGGGAGGCAGG - Intronic
1202820209 11_KI270721v1_random:66010-66032 ACATGGGGAGGGAGGGAGGCAGG - Intergenic
1091815866 12:3437514-3437536 ACTTGAGGGTAGAGGGTGGGAGG - Intronic
1092238239 12:6822716-6822738 ACTGGAGGAGGGAGGGAGGGAGG - Intronic
1092581007 12:9841307-9841329 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1092729266 12:11512974-11512996 ACTTGGGGAGAGTGGGATGCCGG + Intergenic
1092889837 12:12958985-12959007 ACTTGAGGGGAGAGGGTGGGAGG - Intergenic
1093079666 12:14794987-14795009 TCTTTAGGATAGAGGGTGGCTGG + Exonic
1093218490 12:16390443-16390465 ACTTGAGGGTGGAGGGTGGCAGG - Intronic
1093219956 12:16408213-16408235 ACTTGAGGTTGGAGGGTGGGAGG + Intronic
1093686028 12:22054873-22054895 ACTTGAGGGTAGAGGGTGGGAGG - Intronic
1093787832 12:23213306-23213328 ACTTGAGGGTAGAGGGTTGGAGG - Intergenic
1093968601 12:25353313-25353335 ACTCGAGGGTAGAGGGTGGGAGG + Intergenic
1094171125 12:27493174-27493196 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1094226012 12:28046970-28046992 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1094571749 12:31647211-31647233 AAATGAGGATAGGGTGAGGCAGG - Intronic
1095141566 12:38669696-38669718 GCTTGAGCACAGAGGGAGGTGGG + Intronic
1095153827 12:38827815-38827837 ACTTGAGGGTGGAGGAAGGGAGG + Intronic
1095634333 12:44415019-44415041 ACTTGAGGATGGAGAGTGGAAGG - Intergenic
1095728724 12:45481065-45481087 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1095836384 12:46643878-46643900 TCTTGAGGGTAGAGGGTGGGAGG + Intergenic
1095842906 12:46714017-46714039 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1096042983 12:48536233-48536255 ACTTGAGAGCAGAGGGAGGGAGG + Intergenic
1096311411 12:50524547-50524569 GCGGGAGGATGGAGGGAGGCAGG - Intronic
1096410605 12:51374521-51374543 CCTAGAGGAAGGAGGGAGGCTGG + Intronic
1096555995 12:52404198-52404220 TCACGAGGATAGAGAGAGGCAGG - Intronic
1097471633 12:60000300-60000322 ACTTGAGGATAAAGGGTGGGAGG - Intergenic
1098283189 12:68882235-68882257 ACTTGAGGATGGAGGGTGGGAGG - Intronic
1098423070 12:70324968-70324990 ACTTGGGAATAGAGTGAGTCTGG - Intronic
1098776517 12:74627028-74627050 GCTTGAGGGTGGAGGGAGGAGGG - Intergenic
1098989913 12:77054069-77054091 ACTTGAGGGTAGAGGGTGAGAGG + Intronic
1099771434 12:87063605-87063627 ACTTGAAGATGGAGGGTGGGAGG - Intergenic
1100001767 12:89845178-89845200 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1100675065 12:96857286-96857308 ACTTGAGGGTAGAAGGTGGGAGG - Intronic
1100928624 12:99580190-99580212 ACTTGAGGGTAGAGGGTTGGAGG + Intronic
1101054912 12:100902637-100902659 ACATGAGTAGAGATGGAGGCTGG - Intronic
1101470947 12:104996515-104996537 ACTTGAGGATGGAGGGTGGGAGG - Intronic
1102079365 12:110085697-110085719 ACTAGAGGGTAGAGTGAGGTGGG - Intergenic
1102190046 12:110980901-110980923 ACATGAGGAAGGAGTGAGGCAGG + Intergenic
1102318607 12:111911385-111911407 AGTTGAGGGTAGGGGGAGGTAGG + Intergenic
1102370023 12:112375084-112375106 ACCTGGGGATAGAGGCAGGCAGG - Intronic
1102771199 12:115478261-115478283 ACTTGAGGATGGAGGATGGCAGG + Intergenic
1103032965 12:117632684-117632706 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1103257684 12:119556279-119556301 ACCTGAGGATGGAGGGTGGGAGG + Intergenic
1103293107 12:119863357-119863379 ACTAGAGGACAGAGGGTGGGAGG + Intronic
1103437236 12:120936436-120936458 ACTTGCAGAGGGAGGGAGGCAGG - Intergenic
1103511555 12:121478333-121478355 ACTTGAGGGTGGAGGTAGGCAGG - Intronic
1103587160 12:121964470-121964492 ACTGGAGGAAAGAGGCAGGAGGG + Intronic
1104155783 12:126130393-126130415 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1104221713 12:126790920-126790942 AATTGAGGATGGAGGGCGGGAGG + Intergenic
1104737722 12:131148356-131148378 ACTTGAGAGTGGAGGGAGGGAGG - Intergenic
1104812843 12:131628859-131628881 CGTCCAGGATAGAGGGAGGCCGG - Intergenic
1105711556 13:23014363-23014385 ACTTGAGGGTAGAGAGTGGGGGG - Intergenic
1105716612 13:23071895-23071917 GCTTGAGGATAGAGGGTGGGAGG - Intergenic
1105749650 13:23410822-23410844 ACCTGAGGAGAGAGGGAGAGGGG - Intronic
1106363580 13:29055515-29055537 ACTTGAGGGTAGAAGGTGGGAGG - Intronic
1106921255 13:34565951-34565973 ACTTGAGAAGAGTGGGAGGTGGG + Intergenic
1107002377 13:35564030-35564052 GCTTGAGGGTAGAGGGAAGGAGG - Intronic
1107028622 13:35828789-35828811 ACTTGAGGAAAGGGGAAGGGCGG - Intronic
1107182307 13:37475009-37475031 ACATGAGGCTAGAGGGTGGGAGG + Intergenic
1107851869 13:44578242-44578264 ACTGGAGGACAGAAGCAGGCCGG + Intergenic
1108467882 13:50736347-50736369 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1108759689 13:53547630-53547652 ACTTGAGGATGGAGGGTGGGAGG - Intergenic
1108917199 13:55629731-55629753 ACTTGTGGATGGAGGGAGAGAGG - Intergenic
1109254944 13:60068643-60068665 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1109374819 13:61478607-61478629 ACTTGAGGGTAAAGGGAGGGAGG - Intergenic
1109400393 13:61820111-61820133 ACTTGAGGGTGGAGGGAGGTAGG + Intergenic
1110021680 13:70481192-70481214 ACTTGAGGGTGGAGGGTGGAGGG - Intergenic
1110031418 13:70619247-70619269 ACTTGAAGGGAGAGGCAGGCAGG + Intergenic
1110069326 13:71153650-71153672 ACTTGAGGATAGAGGGTGGGAGG - Intergenic
1110149591 13:72234763-72234785 ACTTGAGGATGGAGGGTAGGAGG - Intergenic
1110251650 13:73387232-73387254 ACTTGAGGATGGAGGGTGAGAGG + Intergenic
1110313390 13:74076791-74076813 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1110431930 13:75434487-75434509 ACTTGAGGGTGGAGGGCGGGAGG + Intronic
1110442720 13:75543171-75543193 ACTTGAGGGTAGAGAGTGGGAGG + Intronic
1110482089 13:75990544-75990566 ACTTGAGGGCAGAGGGTGGGAGG + Intergenic
1110523322 13:76506236-76506258 ACTTGAGGGTGGAGGGAGGGAGG + Intergenic
1110559224 13:76892315-76892337 ACTTGAGGGTAGAGGTTGGATGG - Intergenic
1110811549 13:79816803-79816825 ACTTGAGGGTAGAGAGTGGGAGG - Intergenic
1110866465 13:80401639-80401661 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1110907879 13:80916005-80916027 ACTTGAGGGTGGAGGGTGGTAGG + Intergenic
1110926759 13:81163921-81163943 ACATGAGGTTTGAGAGAGGCCGG - Intergenic
1110931871 13:81229726-81229748 ACTACAAAATAGAGGGAGGCAGG - Intergenic
1110992058 13:82054580-82054602 ACTTGAGGATGGAGGATGGGAGG + Intergenic
1110993001 13:82068287-82068309 ACTTGAAGATGGAGGGCGGGAGG + Intergenic
1111101409 13:83593172-83593194 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1111449908 13:88401510-88401532 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1111702971 13:91713939-91713961 AGTGGAGGAGAGAGGGAGACTGG - Intronic
1111868884 13:93805342-93805364 ACTTGGTGATAGAGGGTGACAGG - Intronic
1111892378 13:94099956-94099978 ACTTGAGGGTAGAGGGTGGGAGG + Intronic
1111955706 13:94756040-94756062 ACTTGAGGATGGAGAGAGGGAGG - Intergenic
1112227397 13:97553282-97553304 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1112279064 13:98046809-98046831 ATGTGAGGATACAGGGAGGAAGG - Intergenic
1112306658 13:98280413-98280435 ACATGAGGAAAGAGTGAGCCTGG - Intronic
1112364600 13:98746023-98746045 ACTTGAGGGTAGAGGGTAGGAGG - Intronic
1112460257 13:99597815-99597837 ACTTGAGGGTGGAGGGTGGCAGG - Intergenic
1112782697 13:102918579-102918601 ACTTGAGGGTAAAGGGTGGGAGG - Intergenic
1112783233 13:102924995-102925017 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1112866392 13:103906262-103906284 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1112890966 13:104230971-104230993 ACTAGAGGAGAGAGGGAGGGAGG - Intergenic
1112912577 13:104506294-104506316 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1113068657 13:106396506-106396528 ACTTGAGGATGGAGGGTGGGAGG - Intergenic
1113174611 13:107548121-107548143 ACTCGAGGATGGAGGGTGGGAGG - Intronic
1113247795 13:108417963-108417985 ACTTGAGGGTGGAGGGTGGGTGG - Intergenic
1113358584 13:109607179-109607201 ACCTGAGGGTAGAGGGTGGGAGG - Intergenic
1113363259 13:109651546-109651568 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1113397110 13:109958137-109958159 ACTTGAGGGTGGAGAGAGGGAGG - Intergenic
1113769869 13:112900985-112901007 ATTTCAGGTTGGAGGGAGGCAGG + Intronic
1114057766 14:18988784-18988806 ACTTGAGGGTGGAGAGTGGCAGG - Intronic
1114104781 14:19412969-19412991 ACTTGAGGGTGGAGAGTGGCAGG + Intronic
1114159672 14:20150401-20150423 ACTTGAGGATGGAGGGTGGGAGG + Intergenic
1114678247 14:24460011-24460033 AGTTGGGGGTAGTGGGAGGCTGG + Intergenic
1114842988 14:26288064-26288086 ACTTGAGGATGGAGGTTGGGAGG - Intergenic
1114885979 14:26851847-26851869 ACTTGAGGATGGAGGATGGGAGG - Intergenic
1114902533 14:27082424-27082446 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1115283258 14:31688810-31688832 ACTTGAGGGTGGAGGGCGGGAGG - Intronic
1116252935 14:42509983-42510005 ACTTGAGGGTGGAAGGAGGGAGG + Intergenic
1116282179 14:42923421-42923443 ACTTGAAGATAGAGAGTGGGAGG - Intergenic
1116504254 14:45659431-45659453 ACTTGAGGATGGAAGGTGGGAGG - Intergenic
1116521379 14:45851511-45851533 ACTAGAGGATAGAGATAAGCTGG + Intergenic
1116536383 14:46036209-46036231 ACTTGAGGGTGGAGCGTGGCGGG + Intergenic
1116578611 14:46608782-46608804 ACTTGAAGGTAGAGGGTGGGAGG - Intergenic
1116648350 14:47559235-47559257 ACTTGATGGTAGAGGGAGGGAGG - Intronic
1116671056 14:47843904-47843926 ACTTGAGGGTGGAGGAAGGGAGG - Intergenic
1116805232 14:49488076-49488098 ACTTGAGGGTAGAGGGTGGAAGG - Intergenic
1116816611 14:49590031-49590053 ACTTGAGGGTAGAGGGTGGGAGG + Intronic
1117506565 14:56409601-56409623 ACTTGAGGATGAAGGGTGGGAGG + Intergenic
1117508911 14:56429197-56429219 ACTTAAGGATAAAGGGATGCTGG + Intergenic
1117640680 14:57795946-57795968 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1117671840 14:58115903-58115925 ACTTGAGGGTGGAGGGTGGAAGG + Intronic
1117686017 14:58254050-58254072 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1117752044 14:58934620-58934642 ACTTGAGGATGGAGGGTGGGTGG - Intergenic
1117838633 14:59833680-59833702 ACTTGAGGGTGGAGGGCGGGAGG - Intronic
1118043007 14:61937762-61937784 ACTAGAGGAAAGAGGAAGGATGG + Intergenic
1118271243 14:64344369-64344391 ACTTTAGGGTAGCTGGAGGCAGG - Intergenic
1118536035 14:66765606-66765628 ACTTGAGGGTAGAGGGTGGGAGG + Intronic
1118680432 14:68236053-68236075 ACTTGAGGGTGGAGGGAGGCAGG + Intronic
1119151934 14:72368602-72368624 AATTGAAGCAAGAGGGAGGCAGG - Intronic
1119489867 14:75022159-75022181 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1119643402 14:76330779-76330801 GCTTGAGGACAAAGGGAGGCAGG + Intronic
1119824034 14:77642179-77642201 GCTCGAGGAAAGAGGGAGGACGG - Intergenic
1120030878 14:79639362-79639384 ACTTGAGGGTAGAGGGTAGGAGG - Intronic
1120184545 14:81380817-81380839 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1120415351 14:84212665-84212687 ACTTGAAGGTGGAGGGAGGATGG - Intergenic
1120602108 14:86523633-86523655 AAGTGAGGAAAGAGGGAGGAGGG - Intergenic
1120716201 14:87843514-87843536 ACTTGAGGGGAGAAGGAGGGAGG - Intronic
1120820269 14:88905806-88905828 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1120885616 14:89449777-89449799 AGTTGAGGAGGGAGGGAGGGGGG - Intronic
1121513131 14:94528415-94528437 ACTTGAGGATGAAGGGTGGAAGG + Intergenic
1121837814 14:97107675-97107697 ACTTGAGGGTGGAGTGAGGGAGG + Intergenic
1121942488 14:98085448-98085470 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1122036429 14:98952452-98952474 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1122855759 14:104559420-104559442 AGATGGGGATGGAGGGAGGCCGG - Intronic
1123139320 14:106060080-106060102 ACTGGAGGAGAGAGGGAGGGAGG - Intergenic
1123215870 14:106808867-106808889 AGTGAAGGAGAGAGGGAGGCAGG - Intergenic
1123497700 15:20845433-20845455 ACTTGAGGGTGGAGTGTGGCAGG + Intronic
1123554932 15:21419077-21419099 ACTTGAGGGTGGAGTGTGGCAGG + Intronic
1123591176 15:21856392-21856414 ACTTGAGGGTGGAGTGTGGCAGG + Intergenic
1123769660 15:23516089-23516111 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1123889434 15:24761443-24761465 ACCTGAGGGTAGAGGGTGGGAGG + Intergenic
1125008112 15:34840505-34840527 ACTTGAGGAAAGACTGAGTCAGG + Intergenic
1125443608 15:39729882-39729904 ACTTGAGGGCAGAGGGTGGTAGG + Intronic
1125529172 15:40400572-40400594 ACTTGAGGGTGGAGGGTGGGTGG - Intergenic
1125780750 15:42264850-42264872 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1125843159 15:42824711-42824733 ACTTCAGGATGGAGGGTGGGAGG + Intronic
1125889840 15:43257529-43257551 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1126196786 15:45940175-45940197 ACTTGAGTGTGGAGGGTGGCAGG + Intergenic
1126227127 15:46284046-46284068 ACTTGAGGGTAGAGGGCCGGAGG - Intergenic
1126283403 15:46983866-46983888 ACTTGAGGGCAGAGGGTGGAAGG - Intergenic
1126604162 15:50459027-50459049 ACTTGAGGAAAAAGACAGGCAGG + Exonic
1126657336 15:50993175-50993197 ACTGGAGGGTAGAGGGATGTTGG + Intronic
1126748752 15:51853931-51853953 AGTTGAGGATAGAGGTAGATGGG + Intronic
1127022856 15:54769422-54769444 ACTTGAGGGTGGAGGGAAGGAGG + Intergenic
1127055143 15:55123674-55123696 ACTTGAGGGTGGAGGGTGGAAGG + Intergenic
1127709638 15:61583536-61583558 ACTTGAGGGTGGAGGGAAGAAGG + Intergenic
1128212560 15:65912791-65912813 ACTGCAGGATAGACAGAGGCAGG - Intronic
1128541098 15:68533900-68533922 ACATGAGGATGTAAGGAGGCTGG - Intergenic
1128998399 15:72313603-72313625 ACGTGAGCATGGAGGGAAGCTGG - Intronic
1129081803 15:73047895-73047917 ACTTTAGGGTAGAGGGTGGGAGG - Intergenic
1129569162 15:76660232-76660254 ACTTGAGGATGGAGGGTGCAAGG + Intronic
1129585420 15:76858613-76858635 ACTTGAGGGTAGAGGGTGGGAGG - Intronic
1129666308 15:77581462-77581484 ACTAGAACCTAGAGGGAGGCAGG - Intergenic
1129954069 15:79617586-79617608 ACTTGAGGATAGAGGGTGGAAGG - Intergenic
1129965688 15:79733427-79733449 ACTTGAGGGTGGAGGGTGGAAGG + Intergenic
1129991752 15:79971217-79971239 ACATGATGATACATGGAGGCTGG + Exonic
1130094485 15:80845898-80845920 TCTAGAGGATGGAGGGAGGAGGG - Intronic
1130123412 15:81071717-81071739 ACTTGAGGATGGAAGGTGGGAGG - Intronic
1130252685 15:82310604-82310626 ACTGGAGGACAGAGGGAAGTTGG - Intergenic
1130772360 15:86937643-86937665 ACTTGAGGATGGAGGATGGAAGG + Intronic
1130917959 15:88320895-88320917 AATTGAGGTTAGAGGTGGGCAGG - Intergenic
1131314810 15:91326007-91326029 ACCTGAGGGTGGAGGGTGGCAGG - Intergenic
1131639694 15:94278719-94278741 ACTTGAGGGTAGAGGGAGAGAGG - Intronic
1131956172 15:97738670-97738692 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1202963276 15_KI270727v1_random:146270-146292 ACTTGAGGGTGGAGTGTGGCAGG + Intergenic
1132629606 16:910814-910836 ACAGGAGGACAGAGGGCGGCGGG + Intronic
1133454950 16:5933941-5933963 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1133481023 16:6170740-6170762 GCTTGAGGATAGAGGGTGGGAGG - Intronic
1133535873 16:6701940-6701962 GCTTGAGGATGGAGGGTGGGAGG + Intronic
1133643352 16:7739277-7739299 ACTAGAGCAGAGAGGGAGGGAGG + Intergenic
1133670404 16:8013243-8013265 AGTCGATGATAGATGGAGGCTGG - Intergenic
1133702156 16:8318747-8318769 ACTTCAGAATAGAGGGTGGGAGG - Intergenic
1134258363 16:12630306-12630328 AATTAAGGCTAGGGGGAGGCTGG - Intergenic
1134284812 16:12851552-12851574 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1134384212 16:13756898-13756920 ACTTGAGGAGGGAGGGAAGCCGG - Intergenic
1135246935 16:20864978-20865000 ACTTGAGGGTAGAGGGTGGAGGG + Intronic
1135461197 16:22644754-22644776 ACTTGAGGATAGAGGGTGGGAGG - Intergenic
1135481835 16:22827170-22827192 CCCTGAGGACAGAGGGTGGCTGG + Intronic
1135622812 16:23970394-23970416 ACCTGAGGACAGAGTGAGGTGGG + Intronic
1135952663 16:26929820-26929842 ACTTGAAGGTGGAGGGTGGCAGG - Intergenic
1135997600 16:27263539-27263561 ATTTGAGGATGGAGGGTGGGAGG + Intronic
1136705861 16:32187870-32187892 ACTTAGAGATAGAGAGAGGCAGG + Intergenic
1136762052 16:32741536-32741558 ACTTAGAGATAGAGAGAGGCAGG - Intergenic
1136806046 16:33128850-33128872 ACTTAGAGATAGAGAGAGGCAGG + Intergenic
1137471714 16:48765883-48765905 ACTTGAGGATGGAGGCTGGAAGG + Intergenic
1137837138 16:51603456-51603478 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1137858123 16:51817345-51817367 ACTTGAGGATGGAGGGAAGGAGG - Intergenic
1137944878 16:52724224-52724246 ACTTGAGCATGGAGGGTGGGAGG - Intergenic
1137994556 16:53196052-53196074 AATTAAGGATATACGGAGGCTGG - Intronic
1138125164 16:54432732-54432754 AATTGAGCACAGAGGGCGGCCGG + Intergenic
1138185947 16:54977802-54977824 AGTTCAGGGTAGAGGGTGGCTGG + Intergenic
1138543308 16:57701527-57701549 CCTTCAGAATAGAGGGAGGGAGG + Intronic
1138752914 16:59445760-59445782 CCTTGAGGATGGAGGGCGGGAGG - Intergenic
1138941267 16:61793406-61793428 GCTAGAGGGTAGAGGGAGGGAGG - Intronic
1139275392 16:65723186-65723208 ACTTGAGGGTGGAGGGAGAGTGG - Intergenic
1139835001 16:69831042-69831064 GATTGAGGGCAGAGGGAGGCAGG + Intronic
1139917400 16:70437275-70437297 ACTTGAGAATGGAGGAAGGGAGG - Intronic
1139965065 16:70740781-70740803 AGGTGAGGAATGAGGGAGGCAGG + Intronic
1140288454 16:73627247-73627269 ACTTGGGGACAGAGAGAGGCAGG + Intergenic
1140433041 16:74921241-74921263 ACTTGAGGACGGAGGGTGGGAGG - Intronic
1140542005 16:75764816-75764838 ACTTGAGGGTGGAGGGTGGAAGG - Intergenic
1140775249 16:78243509-78243531 ACTGGAGGGTAGAGGGTGGAAGG - Intronic
1141331157 16:83112320-83112342 GCTTTAGGATAGATGGAGCCTGG - Intronic
1141833109 16:86520694-86520716 AGTTGAGAAGAGAGGGAGTCGGG - Intergenic
1142020777 16:87780876-87780898 ACTTGTGGGCAGAGGGAGGAAGG - Intergenic
1142317835 16:89360051-89360073 ACTTGAGGGGAGAGGGCGGGAGG - Intronic
1203064209 16_KI270728v1_random:1001852-1001874 ACTTAGAGATAGAGAGAGGCAGG - Intergenic
1142748537 17:1973447-1973469 ACTTGAGGTTACAGTGAGCCGGG + Intronic
1142837184 17:2595152-2595174 ACTTAAGGAAAGAGGGAGGGGGG - Intronic
1142921388 17:3190150-3190172 GCTTGGGCACAGAGGGAGGCGGG - Intergenic
1143124669 17:4634026-4634048 ACTTGTGGACAGAGGGTGGAAGG + Intronic
1143348460 17:6268121-6268143 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
1143428167 17:6857018-6857040 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1143602395 17:7956747-7956769 ACTTGAGGCTGGAGGGTGGGAGG - Intergenic
1144085396 17:11803830-11803852 AGTGGAGGAAAGAGAGAGGCAGG - Intronic
1144383225 17:14723734-14723756 ACTTGAGGGTAGAGGGTGAGAGG + Intergenic
1144567295 17:16370302-16370324 ACTTGAGGATGGAGGCAAGAAGG - Intergenic
1145277891 17:21445886-21445908 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1145315715 17:21731752-21731774 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1145404020 17:22570129-22570151 ACTGGAGGATGGATGGAGCCTGG - Intergenic
1146430389 17:32787745-32787767 ACTTGAGGGGAAAGGGAGGGAGG - Intronic
1146532175 17:33617494-33617516 ACTGGAGGGTGGAGGGAGGGAGG + Intronic
1146933671 17:36796281-36796303 ACTGGAGGATAGAGGTGGGAGGG - Intergenic
1147916132 17:43887941-43887963 AATGGAGGAGAGAGGGAAGCTGG + Intronic
1148091444 17:45024755-45024777 ACTTGGGGTGAGAGGGAGGCAGG - Intronic
1148133022 17:45273778-45273800 AATTCAGGCTAGAGGTAGGCAGG + Intronic
1149014822 17:51896237-51896259 CCTTGAGGGTAGAGGGGGACAGG - Intronic
1149041442 17:52194215-52194237 ACTTGAGTTGAGTGGGAGGCAGG - Intergenic
1149063914 17:52457837-52457859 ACCTGAGGATAGAGGGTGGAAGG + Intergenic
1149362119 17:55906355-55906377 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
1149395219 17:56234497-56234519 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1149742044 17:59055769-59055791 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1150057149 17:62028388-62028410 ACTTGAGGGTGGAGGCTGGCAGG + Intronic
1150439646 17:65180795-65180817 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1150594668 17:66593550-66593572 ACTTGGGGGTGGAGGGAGGAGGG + Intronic
1151060709 17:71090568-71090590 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1151530123 17:74698701-74698723 ACTTGAGGATGGAGGGTGGGAGG + Intronic
1151981837 17:77516351-77516373 ACTTGAGGATGAAGGGTGGGAGG - Intergenic
1152482555 17:80564742-80564764 ACTTGAGGGTAGACGGTGGGAGG - Intronic
1153061328 18:997972-997994 ACTTGAGGATGGAGGGTGGGAGG + Intergenic
1153329151 18:3855276-3855298 ACTTGAGGGTGGAGGGAGGGAGG + Intronic
1153444585 18:5156920-5156942 AATTGAGGATAGCTGGAGGAAGG - Intronic
1153760381 18:8325310-8325332 ACCTGAGGGTAGAGGGTGGGAGG - Intronic
1153860212 18:9195176-9195198 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1153973950 18:10250290-10250312 ACTTGAGGATGGAGGCTGGGTGG - Intergenic
1154087670 18:11323006-11323028 ACTTGAGGAGATAGAGAAGCTGG - Intergenic
1154455709 18:14521850-14521872 ACTTGAGGGTGGAGTGTGGCAGG + Intronic
1155248239 18:23931745-23931767 AATTCAGGATAGAGGGAGGGAGG + Intronic
1155262606 18:24059360-24059382 ACTTGACGATGGAGGGTGGGAGG - Intronic
1155576913 18:27258610-27258632 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1155931278 18:31711403-31711425 ACTTGAGGATGGAGGGTGGGAGG - Intergenic
1156012605 18:32512329-32512351 TCTTAAGGATGGAGGGTGGCTGG - Intergenic
1156067868 18:33166925-33166947 ACTTGAGGGTGGAGGGAGGCAGG - Intronic
1156258860 18:35425976-35425998 ACTTGAGGGTGGAGGGAGGGAGG + Intergenic
1156340576 18:36206633-36206655 ACTTGAGGGTAGAAGGTGGGGGG - Intronic
1156561868 18:38134484-38134506 ACTTGAGGCTAGAAGGTGGGAGG - Intergenic
1156731442 18:40197981-40198003 GCTTGGGGACAGAGGGAGGCGGG - Intergenic
1156853188 18:41752120-41752142 AGGTGAGGAGAGAGGGAGACCGG + Intergenic
1156928487 18:42612250-42612272 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1157052529 18:44183985-44184007 ACTGGAGGTTGGAGGGAGGGAGG + Intergenic
1157139717 18:45093687-45093709 ACTTGAGGGTAGAGGGTTGGAGG + Intergenic
1157144338 18:45146235-45146257 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1157170189 18:45396816-45396838 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1157987785 18:52459345-52459367 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1158314206 18:56192782-56192804 ACTAGAGGCTAGGGGGAGGCAGG - Intergenic
1158922458 18:62208654-62208676 ACTTGAAGGTAGAGGGTGGAAGG - Intronic
1159157498 18:64602846-64602868 ACTTGAGGACAGAAAGAGGTAGG + Intergenic
1159330349 18:66986251-66986273 ACTTGAGGAAAGAGGGTAGGAGG + Intergenic
1159370660 18:67523584-67523606 ACTTGAAGGTAGAGTGAGGAAGG + Intergenic
1159485109 18:69045752-69045774 ACTTGAGGGTGGAGGGTGGAAGG - Intronic
1160138885 18:76301004-76301026 GCTTGAGGGTAGAGGGTGGGAGG + Intergenic
1161322294 19:3646893-3646915 ACAGGAGGACAGAGGGAGGAAGG + Intronic
1162885924 19:13697040-13697062 ACTTGAGGGGAGAGGGAGCTGGG + Intergenic
1163256501 19:16159137-16159159 ACTTGAGGAGGGTGGGAGGTGGG + Intergenic
1163488392 19:17602985-17603007 ACTGGAGGAGAGACGGTGGCTGG + Exonic
1164109167 19:22138247-22138269 CGTTGAGGCTGGAGGGAGGCCGG + Intergenic
1164240993 19:23388993-23389015 AGTTGAGGGTGGAGGGTGGCAGG + Intronic
1164892185 19:31833656-31833678 ACTAGAGGGGAGAGGGAGGAGGG - Intergenic
1165665866 19:37627461-37627483 ACTTGAAGACAGAGGGTGGGAGG - Intronic
1165906893 19:39199833-39199855 TCTTGAGAATAGAGGGTGACAGG - Intronic
1165936018 19:39389546-39389568 ACTAGAGGAGAGCGGGGGGCAGG + Exonic
1166025523 19:40080670-40080692 ACTTGAGAGTAGAGGGTGGGAGG + Intronic
1166213880 19:41323580-41323602 GCTTGAGTGTAGAGGGAGGGGGG + Exonic
1166398639 19:42461541-42461563 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1166409126 19:42544714-42544736 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1167857135 19:52251235-52251257 ACTTGAGGATGGAGGCTGGGAGG - Intergenic
1167918079 19:52758615-52758637 ACTTGAGGGTAGAGAGTGGGAGG + Intergenic
1167924062 19:52809472-52809494 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1167995683 19:53400143-53400165 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1168362662 19:55755434-55755456 ACTCGAGGGTAGAGGGTGGGAGG - Intergenic
925426573 2:3753658-3753680 CCTAAAGGATAGAGGAAGGCTGG - Intronic
925531685 2:4869895-4869917 ACTTGAGGATGGAGCGTGGGTGG + Intergenic
925879481 2:8340293-8340315 ACTTGAGGGGACAGGGAGGTAGG + Intergenic
926557235 2:14373287-14373309 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
926981869 2:18580933-18580955 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
927165618 2:20317701-20317723 CCTTGAGGGTAGAGGGTGGGAGG - Intronic
927962772 2:27250919-27250941 CCTTGATGATAGATGGAGGAGGG - Intergenic
928592376 2:32830830-32830852 ACTTGAGGATAGAGACTGGGAGG + Intergenic
928669144 2:33582535-33582557 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
928886142 2:36150671-36150693 ACTTGAGGGTAGAGGATGGGAGG + Intergenic
929038778 2:37722958-37722980 ACCTGAAGAAAGAGGAAGGCTGG + Intronic
929412145 2:41708850-41708872 ACTTGAGGGTAGAGTGTGGGAGG - Intergenic
929557618 2:42935402-42935424 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
929776572 2:44934242-44934264 ACAAGAGGACAGAGGGAGGGAGG + Intergenic
930063315 2:47308901-47308923 AGTTGAGGCTAGAAGGTGGCAGG - Intergenic
930147245 2:48019793-48019815 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
930233640 2:48868052-48868074 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
930425159 2:51203871-51203893 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
930676974 2:54213086-54213108 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
930732703 2:54743903-54743925 ACTAGAGAATAGAGGAAGGAAGG + Intronic
930840357 2:55838435-55838457 ACTTGAGGAGGGAGGGTGGAAGG + Intergenic
931014673 2:57962567-57962589 ACTTGAGGATGGAGGGAGGGAGG - Intronic
931921677 2:67023793-67023815 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
931929871 2:67119684-67119706 ACTTGAGGATGGAGGGTGGGAGG + Intergenic
932173240 2:69576490-69576512 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
933168969 2:79104304-79104326 ACTTGAAGATAGAAGGTGGAAGG + Intergenic
933182225 2:79240366-79240388 CCTTGAGGATAGAGGGTGGGAGG - Intronic
933211439 2:79574363-79574385 ACTTGAGGGTGGAGGGTGGAAGG - Intronic
933285884 2:80384161-80384183 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
933574691 2:84054264-84054286 ACTTGAGGGTGGAGAGAGGGAGG - Intergenic
933587809 2:84199149-84199171 ACTTGAGGGTGGAAGGTGGCAGG - Intergenic
933593074 2:84254531-84254553 CCTTGAGGGTAGAGGGTGGGAGG - Intergenic
934109382 2:88727551-88727573 ACTGAAGGATAGAGGGTGGAGGG - Intronic
934513864 2:94971861-94971883 AGTGAAGGAGAGAGGGAGGCAGG - Intergenic
935345348 2:102102992-102103014 ACTTGAGGATGGAGTGTGGGAGG + Intronic
935491262 2:103723123-103723145 ACTTGAGGGTGGAGGGTGGCAGG + Intergenic
936857119 2:116972046-116972068 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
937397732 2:121553186-121553208 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
937503228 2:122506408-122506430 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
937608322 2:123827868-123827890 ACTTGAGGGTAGAGGGTGAAAGG + Intergenic
938055871 2:128214403-128214425 ACCTGAGGATGGAGGGTGGAAGG - Intergenic
938137972 2:128774832-128774854 ACTTTGGGATGGAGGGAGGCTGG + Intergenic
938181628 2:129189875-129189897 AGTTGAGGACAGTGTGAGGCAGG + Intergenic
938623407 2:133082031-133082053 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
939111079 2:138008135-138008157 ACTTGAGGATGGAGGGTGGGGGG - Intronic
939197091 2:138986791-138986813 ACTTGAGGGTGAAGGGAGGGAGG - Intergenic
939197712 2:138992616-138992638 ACTTGAGGGTGGATGGAGGCTGG + Intergenic
939484465 2:142792776-142792798 ACTTGAGGATGGAGGATGGGAGG + Intergenic
939905850 2:147913626-147913648 ACTTGAAGAATGAGGGAGGGAGG + Intronic
940372018 2:152913140-152913162 ACTAGAGGGTGGAGGGAGGGAGG + Intergenic
940456440 2:153907550-153907572 ACCTTAGGATAGAGGGTGGCAGG - Intronic
940547524 2:155107529-155107551 ACTTTAGGGTGGAGGGAGGGAGG + Intergenic
940628662 2:156209586-156209608 ACTTGAGGGTGGAGGGTGACAGG - Intergenic
940708492 2:157133328-157133350 ACTTGAGGGTTGAGGGTGGGAGG + Intergenic
940730778 2:157388510-157388532 GCTTGAGGGTGGAGGGAGGAAGG - Intergenic
940831685 2:158473648-158473670 ACTTGAGGGTAGAGGGTGGGAGG + Intronic
940865877 2:158817477-158817499 ATTTGGGGCTAGATGGAGGCAGG + Intronic
941425353 2:165338063-165338085 ACTTGAGGGTGGAGGGTGGAAGG - Intronic
941566001 2:167109016-167109038 ACTTGAGGGTAGAGGGTGGGAGG - Intronic
941607061 2:167611000-167611022 ACTTGAGGGTGAAGGGTGGCTGG + Intergenic
941819381 2:169828601-169828623 TCTTGAGGGTTGAGGGAGGAGGG + Intronic
941860934 2:170279611-170279633 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
941886095 2:170529198-170529220 ACTTGAGGTTAGAGGTCGGGAGG + Intronic
941993634 2:171580667-171580689 ACTTGAGGATGGAGAGTGGGAGG - Intergenic
942843040 2:180387336-180387358 ACTTGAGGATAGAGGGTGACAGG - Intergenic
943018042 2:182538130-182538152 ATTTGAGGATATGAGGAGGCAGG - Intergenic
943030045 2:182675102-182675124 ACTTGAGGGTAGAGGGTGAGAGG - Intergenic
943053547 2:182946434-182946456 ACTTGAAGGTAGAGGGTGGGAGG + Intronic
943148940 2:184084870-184084892 ACTTGAAGATGGAGGGTGGGAGG + Intergenic
943155568 2:184170516-184170538 ACTAGAGGGGAGAGGGAGGGAGG + Intergenic
943244968 2:185435082-185435104 AGTTGAGGGTAGAGGGAGAAAGG - Intergenic
943304693 2:186245454-186245476 ACTTGAAGGTAGAGAGAGGGAGG + Intergenic
943312016 2:186337544-186337566 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
943323843 2:186474927-186474949 ACTTGACGGTAGAGGGTGGGAGG + Intergenic
943564587 2:189502977-189502999 ATTTTAGGATAGAGGAAGTCTGG - Intergenic
943611472 2:190039667-190039689 ACTTGAGGGGAGAGGGTGGGAGG - Intronic
943923977 2:193747053-193747075 ACCTGAGGATAAAGGGTGGGAGG + Intergenic
944085855 2:195847487-195847509 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
944101611 2:196033458-196033480 ACCAGAGGCTGGAGGGAGGCAGG - Intronic
944192491 2:197018364-197018386 ATTTAACTATAGAGGGAGGCTGG - Intronic
944263816 2:197702634-197702656 ACTTGAGGGTGGAGGAAGGGAGG - Intronic
944299270 2:198104186-198104208 ACATGAGGATGGAGGGTGGGAGG - Intronic
944420359 2:199523613-199523635 ACTTGAGGGTGGAAGGTGGCAGG - Intergenic
944499506 2:200344219-200344241 ACTTGAGTATGGAGGGTGGAAGG - Intronic
944543494 2:200776927-200776949 GGTTGAGGATAGATGAAGGCTGG + Intergenic
945461618 2:210116201-210116223 GCTTGAGGAAAGAGGAAGGAAGG + Intronic
945541899 2:211098273-211098295 ACTTGTGGGTGGAGGGAGGGAGG - Intergenic
945604114 2:211906699-211906721 ACTTGAGGGTAGAGGGTGGGAGG - Intronic
945798583 2:214395675-214395697 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
946135071 2:217639234-217639256 ACTTGAGGGTGCAGGGAGGAAGG + Intronic
946520874 2:220463552-220463574 ACTTGAGTCTTGAGGGAGGGGGG + Intergenic
946594142 2:221287559-221287581 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
947427838 2:229999855-229999877 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
947438444 2:230094256-230094278 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
947477667 2:230465586-230465608 ACTTGAGGATGGAGGGTTGGAGG + Intronic
948043463 2:234923859-234923881 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
949054622 2:241921066-241921088 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
949079062 2:242082218-242082240 ACTTGAGGCTGGAGGGTGGGAGG + Intergenic
1168922993 20:1556681-1556703 ATGTGAGGATACAGGGAGGGTGG + Intronic
1169252884 20:4073606-4073628 TCTTGGGGATGGAGGGAAGCAGG + Intronic
1169406320 20:5324238-5324260 ACCTGAGGATAGAGGGTGGGAGG - Intergenic
1169989507 20:11485343-11485365 ATTTGAGGGTAGAGGGTGGAAGG - Intergenic
1170247629 20:14240685-14240707 ACTTGAGGGCAGAAGGAGGGAGG + Intronic
1170515410 20:17124441-17124463 ACTTGAGGTTGGAGGGTGGCAGG + Intergenic
1170613733 20:17933432-17933454 CCTTGAGAAGAGAGGCAGGCAGG + Intergenic
1170867991 20:20177440-20177462 ATTTCAGGATGGAGGGAGGGTGG - Intronic
1171010902 20:21508965-21508987 ACCCGAGGACAGAGAGAGGCGGG + Intergenic
1171117904 20:22542473-22542495 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1171153491 20:22848714-22848736 ACTTGAAGATGGAGGGAGGGAGG + Intergenic
1171231088 20:23485908-23485930 ACTTGAGGATAGAGGGTGGGAGG - Intergenic
1171489813 20:25508885-25508907 GCTTCAGGAAAGAGGAAGGCCGG - Intronic
1171902654 20:30871589-30871611 ACTTCAGAATAGTGGGAGGGAGG + Intergenic
1172402464 20:34661358-34661380 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1173111365 20:40193439-40193461 TCCAGAGGATAGAGGGAGACAGG - Intergenic
1173181100 20:40807010-40807032 AGCTCAGGAAAGAGGGAGGCAGG - Intergenic
1173380485 20:42535318-42535340 ACTTGAGGGTAGAGGGAGGGAGG + Intronic
1173517648 20:43676266-43676288 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1173715720 20:45203083-45203105 ACTAGAGGAGAGAAGGAGGGAGG + Intergenic
1173961488 20:47075849-47075871 ACTTGAGGGTAGAGGATGGAAGG - Intronic
1174535250 20:51246445-51246467 ACATGAGGACACAGGGAGGAAGG + Intergenic
1174652489 20:52139496-52139518 ACTTGAAGATGGAGGGTGGGAGG + Intronic
1174710239 20:52696842-52696864 ACTTGAGGATGGAGGATGGGAGG + Intergenic
1174805146 20:53598793-53598815 ACTTGAGGCTGGAGTTAGGCAGG - Intronic
1176818457 21:13631489-13631511 ACTTGAGGGTGGAGTGTGGCAGG - Intronic
1177493359 21:21856914-21856936 ACTTGAGGACAGAGAGTGGGAGG + Intergenic
1177750905 21:25282924-25282946 ACTTGAGGATGGAGGGTGGAAGG + Intergenic
1177886416 21:26751227-26751249 ACTTGAGGGTAGAAGGTGGGAGG + Intergenic
1178060336 21:28846782-28846804 ACTTGAGGGTAGATGGTGGGAGG - Intergenic
1178097304 21:29229886-29229908 AATTGATGTTATAGGGAGGCAGG + Intronic
1178362984 21:31965293-31965315 ACTTGAGGGTGGAGGGTGGAAGG + Intronic
1178471925 21:32901527-32901549 ACTAGAGGGGAGAGGGAGGGAGG + Intergenic
1178489516 21:33040227-33040249 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1178628420 21:34238292-34238314 ACTTGAGGCTGGAGGGTGGGAGG + Intergenic
1178956033 21:37022831-37022853 ACTTGAGGATGGAGGGAGGAGGG - Intergenic
1179086219 21:38220192-38220214 ACTTGAGGGCACAGGGAGGGAGG + Intronic
1179164142 21:38922490-38922512 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
1179174506 21:38997951-38997973 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1179253260 21:39692112-39692134 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1180038774 21:45265097-45265119 CATTGAGGATAGATGCAGGCGGG - Exonic
1180054131 21:45348428-45348450 TTATGAGGCTAGAGGGAGGCTGG + Intergenic
1180062661 21:45393686-45393708 ACTAGAGGACAGAGTGGGGCTGG + Intergenic
1180336044 22:11577559-11577581 ACTTCAGAATAGTGGGAGGGAGG + Intergenic
1180476250 22:15711396-15711418 ACTTGAGGGTGGAGAGTGGCAGG - Intronic
1181461594 22:23089085-23089107 AGGTGAGGAGGGAGGGAGGCAGG + Intronic
1181999833 22:26911251-26911273 TGTTGAGGATAGAGAAAGGCAGG - Intergenic
1182263126 22:29090376-29090398 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1183084985 22:35481163-35481185 AGGTGAGGGCAGAGGGAGGCAGG + Intergenic
1183166253 22:36149184-36149206 ACCTGTGGACAGAGGGAGGTTGG + Intronic
1183598371 22:38825788-38825810 ACCTGGGGATGGAGGGAGGAAGG - Intronic
1184741126 22:46429694-46429716 ACGGGAGGATAGAGTGAGGGAGG + Intronic
1184761890 22:46549611-46549633 AGTTGAGGCCAGAGGTAGGCAGG + Intergenic
1184884798 22:47336330-47336352 AGATGAGGATAGAGGGATGGAGG - Intergenic
1185231045 22:49683023-49683045 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1185382519 22:50516647-50516669 ACCTGAGGAGAGAGGGAGGTAGG - Intronic
949159830 3:867757-867779 AATTGAGGATACACGTAGGCTGG - Intergenic
949270985 3:2216382-2216404 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
949376379 3:3394588-3394610 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
949403021 3:3684830-3684852 AATTGAGGCCAGAGGGTGGCAGG - Intergenic
949478684 3:4472665-4472687 ACCTGTGGAAGGAGGGAGGCAGG + Intergenic
949509571 3:4756476-4756498 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
949932971 3:9094087-9094109 AATTGAGGAAAGAGGGAGGAAGG - Intronic
949939244 3:9141837-9141859 CTTTGAGGATAGATGGAGGCTGG + Intronic
950106394 3:10391712-10391734 ACCGGAGGACAGAGGGAGGGAGG - Intronic
950309569 3:11944997-11945019 ACTTGAGAGTAGAGGGTGGGAGG - Intergenic
951015351 3:17725861-17725883 ACTTGAGGGTTGAGGGTGGGAGG - Intronic
951281240 3:20752550-20752572 ACTTGAGGATTGAGAGAAGTGGG - Intergenic
951433595 3:22636692-22636714 ATTGGAGGATAGAGGGTGGGAGG - Intergenic
951646219 3:24894279-24894301 ACTAGATGGTAGAGAGAGGCAGG - Intergenic
951732814 3:25829373-25829395 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
952195350 3:31069433-31069455 ACTTGAGAAAAGAGGGTGGGAGG - Intergenic
952413499 3:33069953-33069975 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
952569743 3:34700483-34700505 ACTTGAGGGTGGAGGGTGGAAGG + Intergenic
952704238 3:36361096-36361118 ACTTTAGGGTAGAGGGTGGGAGG + Intergenic
952757025 3:36878606-36878628 ACTTGAGGATGGAGGGTGTAAGG + Intronic
953120571 3:40037380-40037402 ATTTAGGAATAGAGGGAGGCAGG + Intronic
953167849 3:40481525-40481547 GCTTCAGGATGGATGGAGGCAGG + Intronic
953225866 3:41019882-41019904 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
953230568 3:41061543-41061565 ACTTGAGGGTAGGGGGTGGGAGG - Intergenic
953230626 3:41062017-41062039 ACTTGAGGGTAGGGGGCGGGAGG - Intergenic
953473132 3:43183599-43183621 ACTTTAGGATAGAGGGAGAAAGG - Intergenic
953745216 3:45568786-45568808 GCTTGAGGGTGGAGGGAGGGAGG - Intronic
953783431 3:45892555-45892577 CCTTGAGGATGGAGGGAGGTAGG + Intronic
954466792 3:50660008-50660030 ACTTCAGGTTAGAGGGAGTTGGG + Intergenic
954657819 3:52207628-52207650 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
954699933 3:52445802-52445824 ACTGGAGGCCTGAGGGAGGCAGG - Intergenic
954960297 3:54558564-54558586 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
954998176 3:54901082-54901104 CCTTGAGGAAAGTGGGAGACGGG + Intronic
955149143 3:56349573-56349595 ACTTGAGGGTTGAGGGTGGGAGG + Intronic
955442136 3:58967856-58967878 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
955509862 3:59668721-59668743 AAATGAGAATAGAGTGAGGCTGG + Intergenic
956032270 3:65051406-65051428 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
956053338 3:65272456-65272478 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
956350763 3:68333471-68333493 ACTTGAGTGTAGAGGGTGGGTGG + Intronic
956354477 3:68376401-68376423 ACTTGAGGGTAGATGGTGGGAGG - Intronic
956372390 3:68577428-68577450 ACTTGAGGGTGGAGGGTGGAGGG + Intergenic
956447364 3:69338678-69338700 ACTTGAGGGTAGAGGGTAGGAGG + Intronic
956577452 3:70768962-70768984 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
956737577 3:72249716-72249738 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
956835441 3:73092655-73092677 ACTTCAGGAAGGAGGGAGGGAGG - Intergenic
957550201 3:81694505-81694527 ACTGGAGAGTAGAAGGAGGCGGG - Intronic
957571732 3:81955528-81955550 ATTTGAGGAAAGAGGCATGCAGG + Intergenic
957746492 3:84349526-84349548 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
957901359 3:86497576-86497598 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
958460784 3:94392029-94392051 ACTTGAGGATGGTGGGTGGGAGG + Intergenic
958551494 3:95619518-95619540 ACTTGAGGATGGAGGGAGGGAGG + Intergenic
958822624 3:98993045-98993067 ACTTGAGGATGGAGGGTAGGAGG - Intergenic
958842908 3:99230270-99230292 ATTTGAGGACAGAGGGTGGTAGG - Intergenic
958843274 3:99234627-99234649 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
958849938 3:99312464-99312486 ACTTGAGGATATAGGGAGGGAGG + Intergenic
958851343 3:99329577-99329599 ACTTGAAGGTGGAGGGAGGGAGG + Intergenic
959098331 3:101981830-101981852 ACTTGAGGGTGGAGGGTGGAGGG - Intergenic
959188120 3:103073332-103073354 ACTTGAGGGTGGAAGGAGGGTGG - Intergenic
959310798 3:104734394-104734416 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
959451387 3:106507393-106507415 ACTTGAGGGCAGAGGGTGGGAGG - Intergenic
959881921 3:111453674-111453696 ACTTTAGGGTAGAGGGTGGGAGG + Intronic
959926111 3:111923640-111923662 ACTAGAGGATGGAGGGTGGAGGG - Intronic
959960413 3:112292108-112292130 ACTTGAGGGTAGATGGTGGGAGG + Intronic
960098166 3:113708202-113708224 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
960118365 3:113921058-113921080 ACTTGAGGGTGGAGGGTGGAAGG - Intronic
960342629 3:116493104-116493126 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
960721731 3:120631074-120631096 ACTTGAGAATAGAGGGTGGGAGG + Intronic
961317654 3:126051483-126051505 ACCTGGGGGCAGAGGGAGGCAGG - Intronic
962341606 3:134590082-134590104 ACTTGAGGATGGAGGGTGGGAGG + Intergenic
962417836 3:135200056-135200078 ACTGGAGGAGAGATGGAAGCAGG - Intronic
962421234 3:135230714-135230736 ACTAGAGGTGAGAGGGAGGGAGG - Intronic
962478328 3:135777354-135777376 ACTTGAGGGTAGAGGTGGGGAGG + Intergenic
962860974 3:139401181-139401203 ACGTGAGGATGGAGGGTGGGAGG - Intergenic
962921482 3:139954121-139954143 ACTTGAGGATGGAGGGTTGGAGG - Intronic
962954869 3:140255599-140255621 ACTTGAGGTTGGAGGGTGGGAGG + Intronic
963035041 3:141018820-141018842 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
963284691 3:143422590-143422612 ACTAGAGGAGGGAGGGAGGAGGG + Intronic
963304160 3:143631944-143631966 ACTTGAAGATATAGAGAAGCAGG + Intronic
963411170 3:144930061-144930083 ACTTGAGGATGGAGGGTAGGAGG + Intergenic
963579769 3:147110659-147110681 ACTTGAGAATGGAGGGTGGGAGG - Intergenic
963609319 3:147445134-147445156 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
963831208 3:150011611-150011633 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
963925919 3:150951138-150951160 TCTTGAGGATGGAGGGTGGGAGG + Intronic
963953966 3:151232779-151232801 ACTTGAGGATGGAGGGTGGGAGG + Intronic
963993848 3:151684272-151684294 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
964158837 3:153621281-153621303 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
964366331 3:155954412-155954434 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
964458666 3:156897043-156897065 ACTTGAGGATAGAGGGTAGGAGG + Intronic
964472457 3:157069739-157069761 ACTTGGGGGTAGAGGGATACAGG + Intergenic
964529862 3:157655845-157655867 ACTTGAGGGTGGAGGGTGGAAGG - Intronic
964676375 3:159286219-159286241 ACTTGAAGCTGGAGGGAGGAAGG - Intronic
964687690 3:159415444-159415466 ACTTGAGGGTAGAGGGTGGGAGG - Intronic
965065827 3:163847362-163847384 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
965193262 3:165559422-165559444 ACTTGAGGGTGGAGGGAGGTAGG - Intergenic
965332936 3:167399857-167399879 ACTAGAGGAGAAAGGGAGGGAGG - Intergenic
965334216 3:167416200-167416222 ACTTGAGGAGGGAGGGTGGGAGG - Intergenic
966042020 3:175503077-175503099 ACTTGAGGGTAGATGGTGGGTGG - Intronic
966289442 3:178338263-178338285 ACTAGAGGATGGAGGGAGAGGGG - Intergenic
966647784 3:182266097-182266119 ACTGGAGGGTAGAGGGTGGGAGG + Intergenic
966663498 3:182444009-182444031 ACTTGAGGATGGAGGGCGGGAGG + Intergenic
967439150 3:189486793-189486815 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
969044135 4:4324228-4324250 GCTTGAGCACAGAGGGAGGAGGG + Intergenic
969464299 4:7345789-7345811 AGTTGGGGAGAGAGGGCGGCAGG - Intronic
969708768 4:8830884-8830906 CCTTGAGGATCCAGGTAGGCTGG - Intergenic
970219410 4:13795368-13795390 ACCTGAGTGTAGTGGGAGGCTGG + Intergenic
970298265 4:14654640-14654662 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
970624711 4:17863992-17864014 ACTTGAGGGCAGAGGGTGGGAGG + Intronic
971412754 4:26392650-26392672 TCCTGGGGATAGGGGGAGGCAGG + Intronic
971434935 4:26610597-26610619 ACTTGATGGTAGAGGGTGGGAGG - Intronic
971461731 4:26906270-26906292 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
971542692 4:27840858-27840880 ACTTGAGGGGAGAGGGCGGGTGG - Intergenic
972125908 4:35765415-35765437 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
972865437 4:43226557-43226579 ACTAGAGGGGAGAGGGAGGTGGG + Intergenic
972876745 4:43371636-43371658 ATTTCAGGGTAGAGGGAGTCAGG + Intergenic
973149717 4:46872317-46872339 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
973677161 4:53276610-53276632 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
973761041 4:54116078-54116100 ACCTGAGGGTAGAGGGTGGGAGG - Intronic
974159851 4:58124523-58124545 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
974162449 4:58157249-58157271 ACTTGAGGGTGGAGGGTGGAAGG - Intergenic
974422838 4:61700056-61700078 ACTTGAGGAAAGAGTAAGGAGGG + Intronic
974642081 4:64644248-64644270 ACTTCAGGGTAGAGGGTGGAAGG - Intergenic
974678791 4:65134025-65134047 ACTTGAGGATGGAGGGCAGGAGG + Intergenic
974765997 4:66347272-66347294 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
974941984 4:68480950-68480972 ACTTGAGGGTTGAGGGTGGGAGG - Intronic
975058900 4:69972353-69972375 ACTTGAGGCTAGAGGTTGGGAGG - Intergenic
975161516 4:71129977-71129999 ACTTGAGGATAGAGGGAGGAAGG + Intergenic
975262398 4:72319043-72319065 ACTTGAGGATGGGGGGAGGATGG - Intronic
975436783 4:74363196-74363218 ACAGTAGGATAGAGGTAGGCTGG - Intergenic
975478334 4:74848789-74848811 ACTTGAGGGTAGAGAGTGGAAGG - Intergenic
975904273 4:79190817-79190839 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
976001817 4:80383176-80383198 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
976015836 4:80553147-80553169 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
976310029 4:83602179-83602201 ACTTCAGGATAGAAGCAGGAGGG - Intronic
976367940 4:84251097-84251119 GCTTGAGGGAAGAGGGTGGCAGG + Intergenic
976640212 4:87329911-87329933 ACTTGAGGGTGGAGGGTGGTAGG - Intergenic
977226839 4:94402458-94402480 ACTTAAGGATGGAGGGTGGGAGG - Intergenic
977252866 4:94708354-94708376 ACTTGAGGGTGGAGGGTGGAAGG - Intergenic
977329471 4:95619342-95619364 ACTTGAGGATAGAGGGTGGGAGG + Intergenic
977403483 4:96564641-96564663 ACTTGAGGGTAGAGGGTGAAAGG - Intergenic
977543014 4:98340867-98340889 ACTTGAGGAGGGAGGGTGGGAGG + Intronic
977552383 4:98456200-98456222 ACTTGAGAGTAGAGGGTGGGAGG + Intergenic
977825652 4:101528592-101528614 ACTGGAGGATATTGGGAGGGAGG + Intronic
978102136 4:104854517-104854539 ACCTGTGGAAAGAGAGAGGCAGG - Intergenic
978207353 4:106093672-106093694 ACTTGAGGCTGGAGGGTGGGAGG + Intronic
978252991 4:106655613-106655635 ACTTGAGAGTAGAGGGTGGGAGG + Intergenic
978264197 4:106803091-106803113 ACATGAGGAAAGAGGGAAGAGGG - Intergenic
978271589 4:106896545-106896567 ACTTGAGGATGGAGGGTGGGAGG + Intergenic
978287055 4:107091834-107091856 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
978352030 4:107830025-107830047 ACTTGAGGGCAGAGGGTGGGAGG - Intronic
978593257 4:110349701-110349723 ACTTGAGGGTGGAGGGTGGAAGG - Intergenic
978870663 4:113573038-113573060 ACTTGAGGAAGGAGGGTGGGAGG + Intronic
979590596 4:122475255-122475277 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
979709946 4:123767678-123767700 ACTTGAGGGTAGAGGGTGTGAGG + Intergenic
979780327 4:124643931-124643953 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
980555424 4:134397258-134397280 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
980635870 4:135501962-135501984 GCTTGAGGGTGGAGGGAGGGAGG + Intergenic
980816074 4:137947890-137947912 ACTTAAGGGTGGAGGGTGGCAGG - Intergenic
980878109 4:138682711-138682733 AAATGATGATAGAGAGAGGCAGG - Intergenic
981252504 4:142620499-142620521 ACTTGAGGATGGAGTGGGGGAGG + Intronic
981339708 4:143607303-143607325 ACTTGAGGATAGAGAAAGGAAGG - Intronic
981495868 4:145391562-145391584 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
981739900 4:147990767-147990789 ACTTGAGGGACGAGGGAGGTCGG + Intronic
981864910 4:149405957-149405979 AATAGAGGATAGAGGAAGGAAGG - Intergenic
982009776 4:151095500-151095522 ACTTGAGAATGGAGGGTGGAGGG + Intergenic
982162325 4:152582820-152582842 ACTTGAGGATGGAGGGTGAGAGG + Intergenic
982389434 4:154848490-154848512 GCTTGAGCACAGAGGGAGGTGGG - Intergenic
982420770 4:155194394-155194416 ACTTGAGGATGGAGGGTGAGAGG - Intergenic
982499623 4:156136851-156136873 ACTTGAAGATGGAGGGTGGGAGG + Intergenic
982690521 4:158542953-158542975 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
982735421 4:159001500-159001522 ACTTGAGGGTAGAGGATGGGAGG - Intronic
983152999 4:164308798-164308820 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
983155641 4:164344219-164344241 ACTTGAGGGTGGAGGGAAGGAGG + Intronic
983447283 4:167869489-167869511 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
983486708 4:168340793-168340815 ACTTGAGTGTAGAGGGTGGGAGG - Intergenic
983683498 4:170380199-170380221 ACTTGAGGGTAGAGGGTGGAAGG - Intergenic
983728426 4:170961032-170961054 ACTGGAGGGTAGAGGGTGGGAGG + Intergenic
984027900 4:174567090-174567112 ACTTGAGGGTGGAGGGTGGCAGG + Intergenic
984516629 4:180749487-180749509 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
986268325 5:6209830-6209852 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
986381024 5:7185834-7185856 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
986576430 5:9218042-9218064 ACTTGAGGGTAGAGGCGGGGAGG + Intronic
986826805 5:11531270-11531292 AGGTGAGGAAAGAGGGAGTCAGG + Intronic
987520839 5:18981400-18981422 ACTTGAGGATGGAGGGTAGTGGG - Intergenic
987629663 5:20452602-20452624 ATTTGAGGGTGGAGGGTGGCAGG + Intronic
987730885 5:21771055-21771077 ACTTGAGGACAGAGAGTGGGAGG + Intronic
987756725 5:22106124-22106146 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
987936970 5:24479427-24479449 ACTTGACATTAGAGGGAGCCAGG + Intergenic
987939285 5:24511979-24512001 ACTTGAGGCTGGAGGGTGGGAGG + Intronic
988004065 5:25385070-25385092 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
988030315 5:25755538-25755560 ACTTGAGGTTGGAGGGTGGAAGG - Intergenic
988058714 5:26137198-26137220 ACTAGAGGAATGAGGGAGGTTGG + Intergenic
988336206 5:29911885-29911907 ACTTGAGGATGGAGGGTGAGAGG + Intergenic
988974492 5:36501520-36501542 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
989126940 5:38063901-38063923 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
989491543 5:42060929-42060951 ACTTGAGCGTAGAGGGTGGAAGG + Intergenic
989709402 5:44378768-44378790 AATTGAGGAAAGAGGCAGGAAGG - Intronic
989980658 5:50640472-50640494 ACTCGAGGGTAGAAGGAGGGAGG - Intergenic
990175780 5:53106544-53106566 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
990215008 5:53521168-53521190 ACTTGAGGGTAGAGGATGGAAGG + Intergenic
990251140 5:53916348-53916370 ACTTGAGGATGGAGGGTGGGAGG + Intronic
990394100 5:55357394-55357416 ACTTCATCATAGAGGCAGGCAGG - Intronic
990634026 5:57703375-57703397 ACTAGAGGAGAGAGGGAGGGTGG - Intergenic
990762845 5:59149685-59149707 ACTCGAGGAGAGAGGGAGAAAGG - Intronic
990769600 5:59228248-59228270 ACTTGAGGATGGAGGGTGGGAGG + Intronic
990831894 5:59968423-59968445 ACTAGAGGGTAGAGGGAGGGTGG + Intronic
990923099 5:60989742-60989764 ACTTGAGGTCAGAGGGTGGGAGG + Intronic
990998780 5:61761089-61761111 ACTTGAGGGTGAAGGGAGGGAGG + Intergenic
991342898 5:65631521-65631543 ATTTGAGGGTAGAAGGTGGCAGG - Intronic
991362884 5:65839536-65839558 ACTTGAGGATGGAGGCTGGCAGG + Intronic
991390909 5:66142659-66142681 ACTTGAGGGTGGAGGGTGGAAGG - Intronic
992089572 5:73304954-73304976 TCTTGAGTACAGAGGGAGGCAGG + Intergenic
992249006 5:74858578-74858600 ACTTGAAGGTAGAGGGTGGGAGG + Intronic
992313871 5:75532234-75532256 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
992921373 5:81525328-81525350 CCTTGAGGATGGAGGGTGGGAGG - Intronic
992931327 5:81649617-81649639 ACTAGAGGTGAGAGGGAGGGAGG + Intronic
993062413 5:83054679-83054701 ACTTGAGGGTGGAGGGTGGGAGG + Exonic
993217400 5:85044035-85044057 ACTTAGGGGTAGAGGGAGGGAGG - Intergenic
993275898 5:85858219-85858241 ACCTGAGGGTAGAGGGTGGGAGG + Intergenic
993374539 5:87134867-87134889 ACTTGAGGTTGGAGGGTGGGAGG + Intergenic
993697090 5:91074322-91074344 ACTTGAGGGTAGAGGGAAAGAGG - Intronic
993801420 5:92347619-92347641 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
994127967 5:96190875-96190897 ACTAGAGGAGAGAGGAAGGAAGG - Intergenic
994228409 5:97282766-97282788 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
994242993 5:97446111-97446133 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
994397414 5:99236567-99236589 ACTTGAGGGTGGAGGAAGGGAGG + Intergenic
994590495 5:101766546-101766568 ACTTGAGGGTGGAGGGTGGAAGG - Intergenic
994618986 5:102140425-102140447 ACTTGAGGGTGGAGGGAGGGAGG - Intergenic
994679848 5:102872913-102872935 ACTTGAGGGTGGAGGGTGGACGG + Intronic
994721677 5:103387519-103387541 ACTTGAGGATGGAGGCTGGGAGG - Intergenic
995013015 5:107278743-107278765 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
995170622 5:109107478-109107500 ACTTGAGGGTAGAGGGTGGAGGG - Intronic
995488488 5:112663883-112663905 ACTTGAGGATGTAGGGTGGGAGG + Intergenic
995653369 5:114396870-114396892 ACCTGAGGGTAGAGGGTGGGAGG - Intronic
995717974 5:115099168-115099190 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
995813181 5:116132737-116132759 ACTTGATAATAGTGGCAGGCTGG + Intronic
995831667 5:116361474-116361496 ACCTGCGGAGGGAGGGAGGCCGG - Intronic
996230188 5:121053705-121053727 ACTGAAGGATGGAGGGAGGAAGG + Intergenic
996469408 5:123842735-123842757 ACTTGAGGATGGAGGGTGGGAGG + Intergenic
996588749 5:125121492-125121514 ACTTGAGGGTAGAGGTTGGGAGG - Intergenic
996631043 5:125632879-125632901 ACTGGGGGCGAGAGGGAGGCTGG + Intergenic
997066198 5:130562342-130562364 ACTTGAGGATGGAGGGTGGGAGG + Intergenic
997099729 5:130955914-130955936 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
997609462 5:135204804-135204826 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
997897109 5:137728823-137728845 ACTTGAGGATGGAGGGTGGGTGG + Intronic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998220323 5:140272714-140272736 ACTTGATGGGAGAGGCAGGCAGG + Intronic
998594833 5:143517832-143517854 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
998692902 5:144606858-144606880 ACTTGAGGGTAGAGGTAGGGAGG - Intergenic
998738471 5:145170837-145170859 ACTAGAGGGTATAGGGAGGGAGG - Intergenic
998776061 5:145604240-145604262 ACTTGAGGGTGGAGGGTGGAAGG - Intronic
999071060 5:148744594-148744616 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
999478329 5:151922242-151922264 ATTTGGGGGTAGATGGAGGCTGG - Intronic
999545745 5:152626437-152626459 AGCTGAGGAAAGAGAGAGGCTGG - Intergenic
999598242 5:153229884-153229906 ACTTGAGGATGAAGGGTGGGAGG - Intergenic
999834951 5:155359707-155359729 ACTTGAGGGTAGAGGATGGAAGG + Intergenic
1000276496 5:159740823-159740845 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1000678444 5:164152926-164152948 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1000821555 5:165990792-165990814 TCTTGAGGATAGGGGGTGGGAGG - Intergenic
1001206276 5:169766217-169766239 GCTTGAGGGTAGAGGGTGGGAGG - Intronic
1001301209 5:170535140-170535162 ACTTGGAGATAGAGCCAGGCAGG - Intronic
1001754519 5:174158271-174158293 ACTTGAGGGTTGAGGGTGGAGGG + Intronic
1001891192 5:175340501-175340523 ACTTGAGGGTTGAGGAAGGGAGG + Intergenic
1002096319 5:176833299-176833321 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1002211273 5:177600609-177600631 GCATGCAGATAGAGGGAGGCTGG - Intronic
1002370060 5:178744820-178744842 ACTGGAGGATGGAGGGAGGGCGG + Intergenic
1002821207 6:726669-726691 ACTTGAGGGTAGAGGGTGAGAGG + Intergenic
1002822961 6:745432-745454 ACTTGAGGGTAAAGGGTGGGAGG + Intergenic
1002838393 6:884837-884859 GCTTGATGATAGATGGAGGCAGG - Intergenic
1003173379 6:3737470-3737492 AGTTGACTATAGAGGGAGGGAGG - Intronic
1003709100 6:8569070-8569092 ACTTGAGGGTAGAGGGAGGAAGG - Intergenic
1003814398 6:9821738-9821760 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1004034076 6:11904926-11904948 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1004059371 6:12177159-12177181 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1005102073 6:22182094-22182116 ACTTGAGGGTAGAGGGTGGAAGG - Intergenic
1005123661 6:22420463-22420485 ACTTGAGGGTAGAGGTTTGCGGG + Intergenic
1005177998 6:23070074-23070096 ACTTGAGGATGGAGGACGGAAGG - Intergenic
1005235924 6:23761958-23761980 ACTGGATGATAGAAGGAGGTAGG + Intergenic
1005244913 6:23872644-23872666 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
1005283241 6:24297305-24297327 ACTTGAGGGTAGAGGGTGGGAGG + Intronic
1005902522 6:30229587-30229609 ATTTGAGGATGGAGGGTGGAAGG - Intergenic
1006044371 6:31281806-31281828 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1006053426 6:31361628-31361650 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1006514387 6:34538026-34538048 CCTGGAGGACAGAGGGAGACAGG - Exonic
1006667618 6:35707701-35707723 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1006798318 6:36744526-36744548 CCTGGAGGAGAGAGGGAGGGTGG + Intronic
1006968503 6:38014795-38014817 TCTTGAGGATACAGGGAAGATGG + Intronic
1007216248 6:40241526-40241548 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1007903113 6:45430318-45430340 ACTTGAGTACATTGGGAGGCTGG + Intronic
1008265007 6:49414275-49414297 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1008736669 6:54552952-54552974 ACTTGAGGGTGGAGGGTGGGTGG + Intergenic
1008779014 6:55079009-55079031 ACTAGAGGAAAGAGAGAGGGAGG - Intergenic
1008779532 6:55086218-55086240 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1009468659 6:64004604-64004626 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1009509108 6:64525517-64525539 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1009521777 6:64691646-64691668 ACTAGAGGATGGAGGAAGGTGGG - Intronic
1009915553 6:69991039-69991061 ACTTGAGGATAGAGAGTGGGAGG - Intronic
1010096814 6:72056257-72056279 ACTTGAGGATGGAGGGTGGGAGG + Intronic
1010252610 6:73723737-73723759 ACTGGAGGGTAGAGGGAGGGAGG + Intronic
1010477310 6:76303882-76303904 ACTTGAGTGTGGAGGGAGGAGGG - Intergenic
1010507221 6:76675405-76675427 ATTTGAGGGTAGAGGGAGGGAGG - Intergenic
1010523516 6:76872225-76872247 ACTTGAGGGTGGAGGGTGGAAGG - Intergenic
1010659441 6:78552439-78552461 ACTTGAGGATGGAGGGTGGGAGG - Intergenic
1010839568 6:80632751-80632773 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1010921013 6:81680637-81680659 GCTAGAGGACAGAGGGAGGAAGG + Intronic
1011117549 6:83910350-83910372 ACTGGTGGAGAGAGGGAGGCTGG + Intronic
1011764558 6:90606181-90606203 ACTTGAGGGTAGATGGAGGATGG - Intergenic
1011921566 6:92583453-92583475 ACTTGGGGGTGGAGGCAGGCAGG + Intergenic
1012155016 6:95808483-95808505 ACTAGAGGGTAGAGAGAGGGAGG - Intergenic
1012222331 6:96664116-96664138 ACTAGAGAAGAGAGGGAGGGTGG + Intergenic
1012435815 6:99214321-99214343 ACTAGAGGGAAGAGGGAGGAAGG + Intergenic
1012577150 6:100816748-100816770 ACCTGAGGGTAGAGGGTGGGAGG + Intronic
1012830499 6:104198725-104198747 ACTTGAGGATGGAGGGTGGAAGG + Intergenic
1013079130 6:106797168-106797190 GCTTGAGGAAAGAGGGTTGCTGG + Intergenic
1013253878 6:108363369-108363391 ACTTGAGTGTAGAGGGTGGGAGG - Intronic
1013314790 6:108931069-108931091 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1013376897 6:109526128-109526150 ACTTGAGGGTAGAGGGTAGGAGG + Intronic
1013766581 6:113581016-113581038 CCTTGAGGGTTGAGGGTGGCAGG + Intergenic
1013899966 6:115143371-115143393 CAGTGAGGATAGAGGTAGGCTGG - Intergenic
1014124894 6:117765539-117765561 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1014214978 6:118744743-118744765 ACTGGAGCATAGAGGAAGGAGGG - Intergenic
1014340077 6:120193493-120193515 ACTTGAGGATGGAGGGTGGGAGG + Intergenic
1014466680 6:121764415-121764437 ACTTGAGGAAGGAGGGAGGAGGG + Intergenic
1014544261 6:122714671-122714693 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1014575017 6:123059044-123059066 CCTGGAGGAGAGAGGGAGGCAGG - Intronic
1014613764 6:123577293-123577315 ACTTGAGGGTGGAGGGTGGCAGG - Intronic
1014907025 6:127042826-127042848 ACTAGAGGATAGAGGGTGGGAGG + Intergenic
1014961204 6:127687471-127687493 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1015160704 6:130149707-130149729 ACTTGAGATTAGAGGGTGGGTGG + Intronic
1015470890 6:133604951-133604973 ACTTGAGGGTTGAGGGTGGAAGG - Intergenic
1015480964 6:133709014-133709036 ACTTGAGGATGGAGGGTGGGAGG - Intergenic
1015528709 6:134199152-134199174 ACTTGATGATAGAGGATGGGAGG + Intronic
1015567674 6:134590428-134590450 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1015692792 6:135944179-135944201 ACTAGAGCATAGAAGGAGGAGGG + Intronic
1015834578 6:137406305-137406327 ACTTGAGGATGGGGGGTGGGAGG - Intergenic
1016084689 6:139898720-139898742 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1016238090 6:141892179-141892201 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1016330145 6:142946102-142946124 CCTTAAGGACAGAGGGAGGGCGG + Intergenic
1016344472 6:143097645-143097667 ATTTGAGGATAGAGGAAAACAGG - Intronic
1016546736 6:145232486-145232508 ACTTGAGGGCAGAGGGTGGGAGG - Intergenic
1016607005 6:145941089-145941111 TCTGGAGGATAGAGTGATGCAGG - Intronic
1016696290 6:147000099-147000121 ACTTAGGGAAAGAGGGAGGCTGG - Intergenic
1016777933 6:147925829-147925851 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1017064601 6:150517745-150517767 ACTTGGTGATAGAGGGAAGGGGG - Intergenic
1017305086 6:152908834-152908856 ACTTGACGGTAGAGGGATGAAGG - Intergenic
1017929856 6:158942360-158942382 ACTTGAGGGTAGAAGGTGGGAGG - Intergenic
1018001448 6:159582014-159582036 ACCTGAGGGTAGAGGGTGGGAGG + Intergenic
1018086095 6:160302449-160302471 ACTTGAGTTTAGAGGGATGGAGG + Intergenic
1018118104 6:160607610-160607632 ATGTGAGGATAGAGAGAGGTTGG - Intronic
1018185411 6:161262149-161262171 ACCTCAGGATAGAAGGAGGGTGG - Intronic
1019183053 6:170204364-170204386 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1019276841 7:180214-180236 CCCTGAGGAGGGAGGGAGGCAGG + Intergenic
1020331056 7:7017383-7017405 ACTTGAGGATGGAGGGTGAGAGG + Intergenic
1020651001 7:10876119-10876141 ACTTGAGGGTAGAGGGTGGAGGG - Intergenic
1020861371 7:13495998-13496020 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1020985939 7:15134448-15134470 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1021370473 7:19839068-19839090 ACTTGAGGAGGGAAGGAGGAAGG - Intergenic
1021485050 7:21158259-21158281 AGTTAAGAATAGAGGGAGGCAGG - Intergenic
1021500257 7:21324823-21324845 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1021572493 7:22080613-22080635 ACTTGAGGGAAGAGGGTGGGAGG + Intergenic
1021611966 7:22466369-22466391 ACTTGAGGGTGGAGGGTGGGGGG - Intronic
1021618485 7:22527099-22527121 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1021889933 7:25177954-25177976 ACTTGAGGGTGGAGAGAGGGAGG - Intronic
1021951483 7:25779227-25779249 ACTTGATTATACAGGTAGGCTGG + Intergenic
1022201655 7:28123099-28123121 GCTAGAGGAGAGAGGGAGGGTGG - Intronic
1022694900 7:32695034-32695056 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1022832958 7:34086663-34086685 GCTTGAGGATGGAGGGAGGAAGG + Intronic
1022838065 7:34135861-34135883 ACTTGAGTATAGGGGGATGAGGG + Intronic
1023044636 7:36200127-36200149 ACTTGAGGATGGAGAGTGGGAGG - Intronic
1023406360 7:39837327-39837349 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1023457144 7:40352457-40352479 ACTTGAGAGTAGAGGGAAGGAGG - Intronic
1023505448 7:40895306-40895328 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1023567519 7:41538359-41538381 ACATGAGGCTAGAGGGAAGCAGG + Intergenic
1023571329 7:41575594-41575616 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1024041001 7:45554171-45554193 ACTTGAGGGTAGAAGGTGGTAGG + Intergenic
1024160016 7:46664298-46664320 ACTTGAAGATAGATGGAAACTGG - Intergenic
1024166016 7:46731095-46731117 ACTTGAGGATGGAGGGTGGGAGG + Intronic
1024254594 7:47531101-47531123 ACTTGAGGGTGGAGGGTGGAAGG + Intronic
1024423323 7:49196203-49196225 ACTTGAGGGTAGAGAGTGGGAGG - Intergenic
1024526387 7:50353480-50353502 AGGTGAGGATAGAGGGAGGAGGG - Intronic
1024733753 7:52280751-52280773 ACTTGAGGGTTGAGGGTGGGAGG - Intergenic
1024969841 7:55058682-55058704 ACTTGAGGGTAGAGGGTTGAAGG + Intronic
1025865864 7:65380014-65380036 AGTTGAGGGTAGAGGGTGGCAGG - Intronic
1026422163 7:70250859-70250881 ACTTGAGGGTGGAGGGTGGTAGG + Intronic
1026533859 7:71223709-71223731 ACTTGAGCATGGAGGGTGGAGGG - Intronic
1026576228 7:71573823-71573845 ACTTGAGGGCAGAGGGTGGGAGG - Intronic
1026602923 7:71791546-71791568 ACTTGAGGATGGAGGGTAGGAGG + Intronic
1026670072 7:72382609-72382631 ACTAGAGGAGAAAGGGAGGGAGG - Intronic
1026866889 7:73829619-73829641 CCTGGAAGATAGAGGGAGGGTGG - Exonic
1027429681 7:78097658-78097680 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1027481610 7:78704998-78705020 ACTTGAGGGTAGAGGGTGAGCGG + Intronic
1027754137 7:82189013-82189035 ACTTGAGTGTAGAGGGCGGGAGG + Intronic
1028143970 7:87301125-87301147 ACTTGAGTGTAGAGGGAAGGAGG + Intergenic
1028233045 7:88328724-88328746 ACTTGAGGGTGGAGGGTGGAAGG - Intergenic
1028346276 7:89787915-89787937 ACTTGAGGGTGGAGGGAGGTAGG - Intergenic
1028757968 7:94459788-94459810 ACTTGAGGGTGGAGGGTGGGTGG - Intergenic
1029264901 7:99330849-99330871 AGTTGGGGGTAGAGGAAGGCTGG + Intronic
1029891217 7:103932382-103932404 ACTTGAGGATGGAGAGTGGGAGG + Intronic
1029981145 7:104880273-104880295 ACATGATGAGAGAGGGAGGGGGG - Intronic
1030168861 7:106581670-106581692 ACTTGAAGATGGAGGGTGGGAGG + Intergenic
1030201151 7:106906187-106906209 AATTGATGAAAAAGGGAGGCAGG - Exonic
1030380371 7:108803984-108804006 AAGGGAGGAGAGAGGGAGGCAGG - Intergenic
1030583963 7:111393421-111393443 ACTTGAGGAAGGAGGAAGGAAGG - Intronic
1030711155 7:112750938-112750960 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
1030718950 7:112846359-112846381 ACTTGAGGGTAGAGGATGGGAGG + Intronic
1030982770 7:116206269-116206291 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
1031558553 7:123208808-123208830 ACTTAAGGATGGAAGGAGGGAGG - Intergenic
1031647742 7:124247464-124247486 ACTTGAGGGTAGAGGGAAGGAGG - Intergenic
1031911645 7:127523055-127523077 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1032371935 7:131364624-131364646 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1032625004 7:133582122-133582144 ACTTGAGGGTAGAGGGAGGGAGG - Intronic
1032914471 7:136473908-136473930 ACTTAAGGATGGAAGGAGGAAGG - Intergenic
1032960941 7:137033339-137033361 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1033150849 7:138913915-138913937 AAATGAGGAAAGAGGGAGACAGG + Intronic
1033259131 7:139827086-139827108 GCTAGAGGAGAGAGGGAGGTGGG - Intronic
1033620261 7:143056131-143056153 ACTTTAGGATGGAGGGAGGGAGG + Intergenic
1033769045 7:144527931-144527953 ACTTGAGGGCAGAGGGTGGGAGG + Intronic
1033931698 7:146531215-146531237 ACTTGAGGATGGAGGGAGGGAGG + Intronic
1034359195 7:150479158-150479180 ACTTGAGGGTGGAGGGTGGCAGG + Exonic
1034849172 7:154477766-154477788 ACCTGATGATACAGGCAGGCTGG - Intronic
1035537323 8:402224-402246 ACTTGAGGCTGGAGGGTGGGAGG + Intergenic
1036055054 8:5242638-5242660 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1036490057 8:9216677-9216699 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1036920416 8:12848307-12848329 ACTTGAGGATGGAGGGTGGTTGG + Intergenic
1037114366 8:15206022-15206044 ACTTGAGGATGGAGGGTGGGAGG + Intronic
1037158034 8:15729704-15729726 ACTTGAGGTTGGAGGGTGGGAGG + Intronic
1037397426 8:18457879-18457901 ACTTGAGGATGGAAGGTGGGAGG + Intergenic
1037429580 8:18795400-18795422 ACTGGAGAACAGAGGGATGCTGG + Intronic
1037524863 8:19714914-19714936 ACTTGAGGGTAGAGGATGGAAGG - Intronic
1038116774 8:24564760-24564782 ACTTGAGGGTAGAGGGTGGAAGG + Intergenic
1038270655 8:26072621-26072643 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1038285065 8:26199126-26199148 ACTCGAGGGTGGAGGGAGGAGGG - Intergenic
1038323671 8:26553373-26553395 ACTTAAGGATGGAGGGTGGGAGG - Intronic
1038817565 8:30920799-30920821 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1038852936 8:31297707-31297729 ACTTAAGGATGGAGGGTGGGAGG + Intergenic
1038854339 8:31314695-31314717 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1038920857 8:32082363-32082385 ACTTGAGGGTGGAGGGTGGAGGG - Intronic
1038949712 8:32401137-32401159 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1039342213 8:36663335-36663357 ACTTGAGGGTGGAGGGTGGAAGG - Intergenic
1039443853 8:37614575-37614597 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1039938780 8:42070830-42070852 ACTTGAGGACACAGTGAGCCTGG - Intergenic
1040370391 8:46765336-46765358 GCTTGAGGAGAGAGGGGGACAGG - Intergenic
1040407615 8:47121803-47121825 ACTTGAGGGTGGAGGGCAGCAGG + Intergenic
1040559512 8:48511792-48511814 ACTTGAGTAGAGAAGGAGGATGG - Intergenic
1040943925 8:52861909-52861931 ACTTGAGGATAGAGGGTGAGAGG - Intergenic
1041013490 8:53567913-53567935 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1041119915 8:54575782-54575804 ACTTGAGGATAGAGTGCGAGAGG - Intergenic
1041695240 8:60728964-60728986 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1041715754 8:60930628-60930650 ACTTGAGGGTAAAGGGTGGGGGG - Intergenic
1041791877 8:61705240-61705262 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1041895007 8:62914339-62914361 ACTTGAGGGTAGAGGATGGGAGG + Intronic
1042046303 8:64656005-64656027 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1042451932 8:68957262-68957284 ACTTGAGGATGGAGGGTGAGAGG - Intergenic
1043230885 8:77799746-77799768 ACTTGAGGGTGGAGGGTGGCAGG + Intergenic
1043358874 8:79446228-79446250 ACTTTGGGAGAGATGGAGGCGGG + Intergenic
1043407815 8:79956627-79956649 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1043506980 8:80911813-80911835 ACTTGAGGATGGAGGGCAGGAGG - Intergenic
1043569433 8:81585989-81586011 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1043586451 8:81775491-81775513 ACTTAAGGATAGAGGGGAGGAGG - Intergenic
1044594308 8:93943201-93943223 GTTTGAGGGTAGCGGGAGGCAGG - Intergenic
1044960850 8:97529296-97529318 ACTTGAGGGTGGAGGGTGGAAGG + Intergenic
1045064222 8:98431298-98431320 ACTGGAGGCTTGTGGGAGGCTGG + Exonic
1045209534 8:100082371-100082393 ACTTGAGGATGGAGAGTGGAGGG - Intronic
1045385064 8:101664680-101664702 TCTTTAGGAGAGAGGGAGGGAGG + Intronic
1045405562 8:101863477-101863499 AGTTGATGATAGAGGAAGCCTGG - Intronic
1045412945 8:101937336-101937358 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1045610104 8:103829701-103829723 ACTTGAGGATGGAGGGTAGGAGG + Intronic
1045619553 8:103958399-103958421 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1045636880 8:104201126-104201148 ACTTGAGGGGAGAGGGTGGGAGG - Intronic
1045702169 8:104879793-104879815 ACTTGTGGAAAGAGGGAGCCAGG - Intronic
1045945867 8:107795201-107795223 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1045952912 8:107871899-107871921 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1046048196 8:108987978-108988000 ACTTGAGGGTAGAGGGAGGGAGG + Intergenic
1046072031 8:109267271-109267293 ACTTGAGGGTGGAGGGAGGGAGG - Intronic
1046139543 8:110072344-110072366 ACTTGAGGGTAGAGGGTAGAAGG - Intergenic
1046225297 8:111270945-111270967 ACTTGAAGGTGGAGGGAGGGAGG - Intergenic
1046282652 8:112053864-112053886 ACTTGAGGGTAGAGAGTGGGAGG - Intergenic
1046290742 8:112156611-112156633 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1046379833 8:113436607-113436629 ACTTGTAGATGGAGAGAGGCTGG - Intronic
1046449563 8:114370809-114370831 ACTTGAGGATGGAAGGTGGGAGG + Intergenic
1046709416 8:117493039-117493061 ACTTGAGGACAGAGGGTAGAAGG - Intergenic
1046782180 8:118227361-118227383 ACTTGAGGGTGGAGGGTGGAAGG + Intronic
1046979747 8:120324066-120324088 ACTTGAGGGTGGAGGGAGACAGG + Intronic
1046989506 8:120435363-120435385 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1047018802 8:120752817-120752839 ACTTGAGGATGGAGGGTGGGAGG + Intronic
1047264891 8:123297240-123297262 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1047277973 8:123420061-123420083 ACTTGAGGGTAGAGGGTGACAGG - Intronic
1047580409 8:126208251-126208273 ATTTGAGGATGGAGGGTGGGAGG - Intergenic
1047764986 8:127983115-127983137 ACAGGAGGCCAGAGGGAGGCAGG - Intergenic
1048236578 8:132696884-132696906 ACTTGAGGGTAGAGGGTGGGAGG + Intronic
1048525333 8:135197235-135197257 TCCTGAGGATATAAGGAGGCAGG - Intergenic
1048668715 8:136693425-136693447 ACTTGAGGATAGAGGGTCAGAGG - Intergenic
1048723039 8:137348929-137348951 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1048754578 8:137723440-137723462 ACTTGAGGACAGAGGGTGGGAGG - Intergenic
1048925145 8:139264879-139264901 ACCTGAGGGTGGAGGGAGGAGGG - Intergenic
1049115780 8:140686234-140686256 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1049137234 8:140914571-140914593 ACTTGAGGGTGGAGGGAGGAAGG - Intronic
1049652670 8:143780470-143780492 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1049790395 8:144469743-144469765 CCTGGAGGAGAGAGGGTGGCTGG + Intronic
1049966207 9:782406-782428 ACTTTGGGAGAGAGCGAGGCAGG - Intergenic
1050052749 9:1620329-1620351 ACTGAAAGATAGAGGCAGGCTGG + Intergenic
1050145445 9:2562357-2562379 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1050175787 9:2868215-2868237 ACATGAGGATAGAGGGTGGGAGG - Intergenic
1050498082 9:6265539-6265561 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1051033463 9:12713222-12713244 ACTGAAGGGTAGAAGGAGGCAGG + Intergenic
1051145138 9:14019362-14019384 ACTTGAGGGTGGAGGGAGGGAGG - Intergenic
1051524187 9:18024411-18024433 ACTAGAGGAAGGAGGGAGGGAGG - Intergenic
1052071458 9:24086783-24086805 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1052567958 9:30182768-30182790 ACTAGAGGATGGAGGGTGGGAGG - Intergenic
1052626822 9:30986034-30986056 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
1052669204 9:31534092-31534114 ACTTGAGGGTGGAGGGTGGAGGG - Intergenic
1052735477 9:32338042-32338064 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1052795624 9:32920937-32920959 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1053035117 9:34820380-34820402 ACTTGAGGGTGGAGGGTGGAAGG - Intergenic
1053531255 9:38883848-38883870 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1053806944 9:41812379-41812401 ACTTGAGGATGAAGGGTGGGAGG - Intergenic
1053822561 9:41983035-41983057 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1054138671 9:61456131-61456153 ACTTGAGGATGGAGGGTAGGAGG - Intergenic
1054203479 9:62108280-62108302 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1054608015 9:67204331-67204353 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1054634883 9:67480084-67480106 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1054750477 9:68899913-68899935 ACTTGAGGGTGGAGGGCGGGAGG - Intronic
1054932475 9:70650152-70650174 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1055624131 9:78155756-78155778 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1055874965 9:80931464-80931486 ACTTGAGGCTGGAGGGTGGGAGG + Intergenic
1055913211 9:81374487-81374509 AGGAGTGGATAGAGGGAGGCAGG + Intergenic
1055990984 9:82105344-82105366 ACTTGAGGGTGGAGGGTGGGTGG - Intergenic
1056298868 9:85221364-85221386 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1056669178 9:88609305-88609327 ACTTGAGGGTGGAGGGTGGAAGG - Intergenic
1056918689 9:90766230-90766252 AGTTGGGAATAGAGGTAGGCAGG + Intergenic
1057360314 9:94367302-94367324 ACTTGAGGGTGGAGGGTGGGGGG - Intergenic
1057380683 9:94564656-94564678 ACGTGAGGGTGGAGGGAGGGAGG + Intronic
1057395135 9:94673498-94673520 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1057530307 9:95839218-95839240 GCCTGAGGATAGAGGGAGCTGGG - Intergenic
1057663026 9:97020775-97020797 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1057695412 9:97319481-97319503 ACTTGAGGGTGGAGGGTGGAAGG - Intronic
1058747856 9:108009220-108009242 GCTTGAGAATAGGGGGAGCCTGG + Intergenic
1058831364 9:108820213-108820235 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1058851970 9:109021335-109021357 ACATCAGGATGGAGAGAGGCTGG + Intronic
1058884125 9:109310336-109310358 ACTTCAGGAGGGAGGGAGGGAGG + Intronic
1059003328 9:110374148-110374170 ACTTGAGGGTAGAGGGTGGGAGG - Intronic
1059095958 9:111415028-111415050 ACTTGAGGAGAGAGGGTGGGAGG + Intronic
1059260471 9:112971255-112971277 ATTGAAGGAAAGAGGGAGGCAGG + Intergenic
1059678192 9:116560549-116560571 ACTTGAGGCTGGAGGGAAGCTGG - Intronic
1059839759 9:118200761-118200783 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1059876245 9:118638316-118638338 ATTAGAGGAGAGAGGGAGGAAGG - Intergenic
1060424499 9:123493243-123493265 ACTGGAGCCTTGAGGGAGGCAGG + Intronic
1060549134 9:124476964-124476986 AGGGGAGGACAGAGGGAGGCAGG - Intronic
1060948018 9:127581805-127581827 ACATGGGGAGAGAGGGAGGGAGG - Intergenic
1060948040 9:127581886-127581908 ACATGGGGAGAGAGGGAGGGAGG - Intergenic
1060948049 9:127581913-127581935 ACATGGGGAGAGAGGGAGGGAGG - Intergenic
1060948081 9:127582017-127582039 ACATGGGGAGAGAGGGAGGGAGG - Intergenic
1060948090 9:127582044-127582066 ACATGGGGAGAGAGGGAGGGAGG - Intergenic
1061616200 9:131780884-131780906 ACTTGAGGGTAGAGGGTGGGCGG + Intergenic
1203528902 Un_GL000213v1:118018-118040 ACTTGAGGGTGGAGTGTGGCAGG + Intergenic
1185693193 X:2173731-2173753 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1185801530 X:3015689-3015711 TCTAGAGGAGAGAGGGAGACAGG + Intronic
1185918882 X:4066923-4066945 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1185921670 X:4100005-4100027 ACTTGAGGATGAAGGGTGGGAGG - Intergenic
1185957915 X:4512460-4512482 ACTCAGGGATAGAGGGAGGAAGG + Intergenic
1186148604 X:6650447-6650469 TCTTAAGGATAGAAGGAGGTGGG + Intergenic
1186310435 X:8311902-8311924 GCTTGAGGATGGAGGGTGGGAGG + Intergenic
1186605634 X:11087588-11087610 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1186616668 X:11195655-11195677 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1186632400 X:11364198-11364220 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1186921004 X:14280251-14280273 ACTTGAGGGTAGAGGGCGGGAGG - Intergenic
1187035392 X:15533340-15533362 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1187047829 X:15665322-15665344 ACTTAAGGTTAGAGGGTGGGAGG + Intergenic
1187047907 X:15666078-15666100 ACTTGAGGATAGTGGGTGGGAGG + Intergenic
1187053639 X:15718827-15718849 ACTTGAGGGTAGAGGGTGGGAGG + Intronic
1187054288 X:15727336-15727358 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1187184903 X:16974861-16974883 ATTGGAGGATGGAGGGTGGCAGG - Intronic
1187492994 X:19770194-19770216 ACTTAAGGGTAGAGGGTGGAAGG - Intronic
1187600288 X:20821740-20821762 ACTTGAGGGTGGAGGGTGGAAGG + Intergenic
1187746430 X:22414222-22414244 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1187755868 X:22525542-22525564 ACTTGAGAGTGGAGGGAGGGAGG + Intergenic
1187756430 X:22532175-22532197 ACTTGAGGGTAGAAGGTGGGAGG + Intergenic
1187820297 X:23280243-23280265 ACTTGAGGGTGGAGGGCGGGAGG + Intergenic
1188172569 X:26945970-26945992 ACTTGAGGGTGGAGGGTGGTAGG - Intergenic
1188259146 X:28001911-28001933 ACTTGAGGGTGGAGGGAGGGAGG - Intergenic
1188326941 X:28816392-28816414 ACTCGAGGAAGGAGGGAGGAAGG - Intronic
1188362307 X:29271008-29271030 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1188471019 X:30539277-30539299 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1188516577 X:30994013-30994035 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1188625501 X:32279623-32279645 ACTTGGAGATAGAGGGTGGAAGG + Intronic
1188635600 X:32426948-32426970 ACTTGAGGATAGAGAATGGGAGG + Intronic
1188810566 X:34649544-34649566 ACTTGAGGGTTGAGGGTGGGAGG + Intronic
1188828940 X:34872555-34872577 ACTTGAGGGTAGAGTGTGGGAGG + Intergenic
1188850786 X:35129280-35129302 ACTAGAGGATGGAGGGTGGGAGG - Intergenic
1188921336 X:35981670-35981692 ACTTGAGGATGGAGGTTGGGAGG - Intronic
1188982637 X:36740639-36740661 ACTTCAGGATGGAGGGTGGGAGG - Intergenic
1189121927 X:38404405-38404427 GTTTGAGGATAGAGGTAGGAGGG + Intronic
1189596191 X:42568274-42568296 ACTTGAGGGTGGAGGGTGGAGGG - Intergenic
1189638734 X:43043917-43043939 CCTTGAGGGTAGAGGGTGGGGGG - Intergenic
1190167930 X:48088558-48088580 ACTTGAGAGTGGAGGGAGGGAGG + Intergenic
1190194347 X:48304622-48304644 AGTTGATGATAGAGCGAGGATGG + Intergenic
1190447934 X:50549240-50549262 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
1190880649 X:54490178-54490200 ATTTGAGGGTGGAGGGAGGGAGG + Intronic
1191738373 X:64411048-64411070 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
1191763810 X:64673687-64673709 ACTTGAGGGTTGAGGGTGGGTGG + Intergenic
1191926423 X:66315750-66315772 ACTTGAGAGTAGAGGGTGGGAGG + Intergenic
1191927716 X:66331872-66331894 ACTTGAGGGTGGAGGGTGGAAGG - Intergenic
1192019429 X:67369566-67369588 ACTTGAGGGTGGAAGGTGGCAGG + Intergenic
1192075785 X:67994716-67994738 ACTTGAGGGTGGAGGGAGGCAGG - Intergenic
1192354820 X:70391765-70391787 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1192397756 X:70800237-70800259 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1192488139 X:71548751-71548773 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1192831846 X:74758555-74758577 ACTTGAGGGTGGAGGGAGGGAGG - Intronic
1193160582 X:78224603-78224625 ACTTGAGGATGGAGAGTAGCAGG + Intergenic
1193187065 X:78525978-78526000 ACTTGAGGGTGGAGGGTGGAAGG + Intergenic
1193289690 X:79757171-79757193 ACTTCAGGATGGAGGGTGGGAGG - Intergenic
1193437840 X:81500425-81500447 ACTTGAGGATAGAGGTTGGGAGG + Intergenic
1193512773 X:82426168-82426190 ACTTGAGAGTGGAGGGAGGGAGG - Intergenic
1193570440 X:83134959-83134981 ACTTGAGTGTGGAGGGAGGGAGG + Intergenic
1193637181 X:83965974-83965996 ACTTGAGGATAGAGGGTGGGAGG + Intergenic
1193722192 X:85000274-85000296 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
1193748742 X:85316870-85316892 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1193794689 X:85859191-85859213 ACTAGAGGAGGGAGGGAGGGAGG + Intergenic
1193825374 X:86219456-86219478 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1194077589 X:89415927-89415949 ACTTGAGGAGGTAGGGAGGAAGG + Intergenic
1194091921 X:89587788-89587810 ACTTGAGGGTGGAGGGTGGCTGG + Intergenic
1194133540 X:90110984-90111006 ACTTGAGGGTGGAGGGTGGAAGG - Intergenic
1194407188 X:93511266-93511288 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1194484208 X:94467075-94467097 ACTTGAGGGTAGAGGGTGGGAGG + Intergenic
1194619111 X:96146714-96146736 ACCTGAGGATGGAGGGTGGGAGG + Intergenic
1194652866 X:96536239-96536261 ACCTGAGCATAGAGGGAGTAGGG - Intergenic
1194891521 X:99384919-99384941 ACTTTGGCACAGAGGGAGGCTGG - Intergenic
1194912561 X:99664823-99664845 ACTTGAGGGTGGAGGGTGGAAGG - Intergenic
1195004478 X:100672351-100672373 ACTTGAGGGGAGAAGGAAGCAGG + Intergenic
1195145130 X:102006444-102006466 ACTTGAAGATAGAGGGTGAAAGG + Intergenic
1195227775 X:102815883-102815905 ACCTGAGGGTAGAGGGAGAGAGG + Intergenic
1195280256 X:103326538-103326560 ACTTGAGGGTGGAGGGTGGCAGG + Intergenic
1195448557 X:104981984-104982006 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1195602272 X:106762867-106762889 ACTTGAGGGTGGAGGAAGGGAGG + Intronic
1195783544 X:108490796-108490818 ACTTGAGAACAGAGGGTGGAAGG - Intronic
1195847164 X:109241274-109241296 CCTAGAGGAGAGAGAGAGGCAGG - Intergenic
1195909372 X:109874468-109874490 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1195979725 X:110564359-110564381 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1196494607 X:116309758-116309780 ACTTAAGGGTGGAGGGAGGGAGG - Intergenic
1196504114 X:116420688-116420710 ACTCGAGGATAGAGGGTGGGAGG - Intergenic
1197122795 X:122912122-122912144 ACTTGAGGGTGGAGGGTGGGAGG + Intergenic
1197177010 X:123496731-123496753 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1197259265 X:124299694-124299716 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1197347263 X:125339108-125339130 ACTTGAGGAGTGAGGGATACAGG - Intergenic
1197353596 X:125406338-125406360 ACTTGAGGGTAGAGGGTGAGAGG - Intergenic
1197367232 X:125579150-125579172 ACTTGAGGGTGGAGGGTGGAAGG - Intergenic
1197372696 X:125644468-125644490 ACTTGAGGATAGAGGATTACAGG - Intergenic
1197621322 X:128752968-128752990 ACTTGAGGAGGGAGGGCGGGAGG - Intergenic
1197782652 X:130172626-130172648 ACCTGTGGGCAGAGGGAGGCAGG + Intronic
1197791074 X:130254754-130254776 ACTTGAGGGTGGAGGGTGGGAGG + Intronic
1197845018 X:130792247-130792269 ACTTGAGGGTGGAGGGTGGAAGG + Intronic
1197913171 X:131507553-131507575 ACTTGAGGGTGGAGGGTGGAAGG - Intergenic
1197916968 X:131546186-131546208 AATTGGGGGTAGAGGGAGGAAGG - Intergenic
1197970141 X:132106867-132106889 ACTTGAGGGTGGAGTGTGGCAGG + Intronic
1197984446 X:132252929-132252951 ACTTGAGGACGGAGGGTGGGAGG + Intergenic
1198063208 X:133068247-133068269 ACTTGAGGGTAGAGGGAGGAAGG + Intronic
1198076574 X:133199050-133199072 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1198195309 X:134354784-134354806 ACTTGAGGAGGGAGGGCGGGAGG - Intergenic
1198528110 X:137522491-137522513 ACTTGAGGGTAGAGGTTGGGAGG - Intergenic
1198578990 X:138042547-138042569 AGGTAAGGATAGAGGGAGGGAGG + Intergenic
1198722295 X:139635870-139635892 ACTTGAGGGTGGAGGGTGGGAGG - Intronic
1198837717 X:140821829-140821851 ACTTGAGGATGGAGGGTGGGAGG - Intergenic
1198895187 X:141446297-141446319 ACTTGAGGGTAGAGGATGGAAGG - Intergenic
1198945458 X:142008158-142008180 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1198957917 X:142152065-142152087 ACTTAAGGATGGAGGGTGGGAGG - Intergenic
1199193591 X:145001240-145001262 ACTTGAGGGTGGAGGGTGGGAGG - Intergenic
1199257751 X:145735985-145736007 ACTTGAGGACAGAGGGTGGGAGG + Intergenic
1199338467 X:146647205-146647227 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
1199469142 X:148174530-148174552 ACTTGAGGGTAGAGGGTGAGAGG - Intergenic
1199791378 X:151158443-151158465 ACTGGAGGGTGGAGGGAGGGAGG - Intergenic
1200046886 X:153407983-153408005 ACTTGAGGTTGGAAAGAGGCTGG + Intergenic
1200234053 X:154459785-154459807 AGCTGAGGGGAGAGGGAGGCAGG - Intronic
1200383269 X:155862125-155862147 ACTTGAGGGTAGAGGGTGGGAGG - Intergenic
1200430238 Y:3071471-3071493 ACTTGAGGAGGTAGGGAGGAAGG + Intergenic
1200479320 Y:3681087-3681109 ACTTGAGGGTGGAGGGTGGAAGG - Intergenic
1200979477 Y:9248574-9248596 ACTCCAGGATAGAGGGTGACTGG - Intergenic
1201227328 Y:11830960-11830982 ACTTGAGGATGGAGGGTGGGAGG - Intergenic
1201538702 Y:15082439-15082461 ACTTGAGGGTGGAGGAAGGGAGG - Intergenic
1201950510 Y:19558563-19558585 ACCTGAGATTAGAGGCAGGCAGG - Intergenic
1202068050 Y:20961034-20961056 TCTTTAGGATTGAGGGAGACTGG + Intergenic