ID: 1064899345

View in Genome Browser
Species Human (GRCh38)
Location 10:20276763-20276785
Sequence CAGCCAGGGATTTCAGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 324}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064899345_1064899349 8 Left 1064899345 10:20276763-20276785 CCCTTCTCTGAAATCCCTGGCTG 0: 1
1: 0
2: 3
3: 29
4: 324
Right 1064899349 10:20276794-20276816 CATGCTTGCAAGTTTGTGACAGG No data
1064899345_1064899351 13 Left 1064899345 10:20276763-20276785 CCCTTCTCTGAAATCCCTGGCTG 0: 1
1: 0
2: 3
3: 29
4: 324
Right 1064899351 10:20276799-20276821 TTGCAAGTTTGTGACAGGGCTGG No data
1064899345_1064899350 9 Left 1064899345 10:20276763-20276785 CCCTTCTCTGAAATCCCTGGCTG 0: 1
1: 0
2: 3
3: 29
4: 324
Right 1064899350 10:20276795-20276817 ATGCTTGCAAGTTTGTGACAGGG No data
1064899345_1064899352 21 Left 1064899345 10:20276763-20276785 CCCTTCTCTGAAATCCCTGGCTG 0: 1
1: 0
2: 3
3: 29
4: 324
Right 1064899352 10:20276807-20276829 TTGTGACAGGGCTGGACATGAGG No data
1064899345_1064899353 27 Left 1064899345 10:20276763-20276785 CCCTTCTCTGAAATCCCTGGCTG 0: 1
1: 0
2: 3
3: 29
4: 324
Right 1064899353 10:20276813-20276835 CAGGGCTGGACATGAGGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064899345 Original CRISPR CAGCCAGGGATTTCAGAGAA GGG (reversed) Intronic
900369744 1:2326404-2326426 CCCCCAGGGCTTTGAGAGAACGG + Intronic
902727438 1:18346660-18346682 CAGCCAGCGATCGCAGAAAATGG + Intronic
902876804 1:19345285-19345307 AAGCCAGAGATTTCTGAGAACGG + Intronic
903778900 1:25809482-25809504 CAGGCAGGGCTTCCAGAGGAGGG + Intronic
904499756 1:30907315-30907337 CCGTCAGGGATGGCAGAGAAAGG - Intronic
904564840 1:31422664-31422686 CACCCAGGGATTTAAGAGCCTGG - Intronic
904923663 1:34028941-34028963 CTGCTAGGGATTTTGGAGAAAGG - Intronic
904981675 1:34508618-34508640 CAGCCTGGAGTTCCAGAGAAAGG + Intergenic
906657082 1:47556098-47556120 CAGCCGTGGATTTCAGGGAGAGG + Intergenic
906666097 1:47623141-47623163 CAGGCAGGCATTTCCGGGAAAGG + Intergenic
906691095 1:47793135-47793157 CAGCCATAGGTTTTAGAGAAGGG - Intronic
908326940 1:63032225-63032247 CAGCCAGGCATTTTAAAGAGGGG - Intergenic
909103184 1:71376754-71376776 CAGCAAGAGTTTTCAGAAAATGG + Intergenic
910645283 1:89507769-89507791 ATGCCAGGGATTGCAGAGATAGG - Intergenic
911441665 1:97934652-97934674 CAGCCAGAGATTTCAGGGTGAGG - Intergenic
911685142 1:100766964-100766986 CCACCAGGGATTTTAGACAAAGG + Intergenic
912391463 1:109306171-109306193 CAGCCAGGGCATTCAGGGATGGG + Intronic
912626860 1:111212682-111212704 CAGCCAGGGAGGCCAGGGAACGG - Intronic
913069352 1:115285221-115285243 CAGCCAGGGAAGCCAGAGACGGG - Intergenic
913088044 1:115457201-115457223 CAGCCATTGTTATCAGAGAATGG + Intergenic
913229451 1:116729738-116729760 AGGCCAGGGTCTTCAGAGAATGG - Intergenic
916173805 1:162021777-162021799 CACCCAGGGTTCTCAGAGCAGGG - Intronic
916777584 1:167983595-167983617 CAGCCAGAGATGTTAGAGTAGGG + Intronic
917827054 1:178834536-178834558 CACCCTAGGATTGCAGAGAATGG + Intronic
917908060 1:179609199-179609221 CAACCAAGCATTTCAGATAAGGG - Intronic
917982262 1:180277427-180277449 CAGCCAGGCACTGCAGATAATGG - Exonic
918244900 1:182650467-182650489 GAGCCAGGAACTTAAGAGAAAGG + Intronic
918307589 1:183261142-183261164 CTGCCAGGACTCTCAGAGAAGGG + Intronic
919080534 1:192860534-192860556 GATGCAGGGAGTTCAGAGAAAGG - Intergenic
919132554 1:193469496-193469518 AAGCCAGGGCTTTCTGAGCAAGG - Intergenic
919238607 1:194880412-194880434 AATCCAGGAATTTCAGAAAAGGG + Intergenic
920140609 1:203809419-203809441 CAACCTGGGATTTCGGAGATGGG - Intronic
920191827 1:204198695-204198717 CTGCCAGGTGCTTCAGAGAAAGG + Intronic
920865195 1:209746386-209746408 CAGCCAGGACTCTCTGAGAATGG - Intergenic
921922219 1:220683024-220683046 GTGCCTGGGATTCCAGAGAAGGG + Intergenic
922499091 1:226083660-226083682 CAGCCAGGGCTGGCGGAGAAGGG - Intergenic
923164526 1:231347087-231347109 GTCCCAGGCATTTCAGAGAAGGG - Intronic
923450103 1:234109272-234109294 CAGGAAGGAATTTTAGAGAAAGG + Intronic
923728087 1:236524310-236524332 CAGCCAGGGATGTCCAAGAAAGG - Intronic
1062779081 10:184981-185003 AAGCCCGGTATTACAGAGAAAGG - Intronic
1062929817 10:1345304-1345326 CAGCCAGGGTTTCCAAAGGAGGG - Intronic
1063193567 10:3719309-3719331 CGTCCAGGGACTGCAGAGAAGGG + Intergenic
1063417113 10:5882693-5882715 GAGCCAGGAATTTCATACAATGG + Intronic
1064899345 10:20276763-20276785 CAGCCAGGGATTTCAGAGAAGGG - Intronic
1065973294 10:30822072-30822094 CAGCCATGGATTGCAGAGGGCGG - Intronic
1067452095 10:46388033-46388055 CAGCCAGGAATTTCACAGGCAGG - Intronic
1067553613 10:47252734-47252756 CAGCAAGGGGGCTCAGAGAATGG + Intergenic
1067585142 10:47471722-47471744 CAGCCAGGAATTTCACAGGCAGG + Intronic
1067926615 10:50514900-50514922 CAGTCTGGGAGTTCAGAGACTGG - Intronic
1068696069 10:59969342-59969364 ATGCCAGGAAATTCAGAGAATGG + Intergenic
1070297789 10:75178729-75178751 CAGCCATGTTTTTAAGAGAATGG - Exonic
1070562141 10:77576016-77576038 CAGCCATGGATTGGGGAGAATGG + Intronic
1071376609 10:85012135-85012157 TTGCCAGAGATTTCTGAGAATGG - Intergenic
1071574968 10:86718559-86718581 GACCCAGGGGTGTCAGAGAAGGG - Intronic
1071737000 10:88312020-88312042 CATCAAGGGATTTGGGAGAAAGG + Intronic
1072038645 10:91587144-91587166 GAGCCAGGGGTTTAAGTGAATGG - Intergenic
1072400878 10:95098465-95098487 GCTCCAGGGATTTCAGATAAAGG - Intergenic
1072717580 10:97761964-97761986 CAGGCATGGATTACAGAGATGGG + Intergenic
1074425404 10:113347042-113347064 CAGCCAGACCTTTCAGAGAGGGG - Intergenic
1075287501 10:121200060-121200082 GTGCCAGGCATTTCAGATAAGGG - Intergenic
1075771270 10:124938733-124938755 CAGCCTGGGATGACAGAGCAAGG - Intergenic
1076890979 10:133283242-133283264 CAGCCACGTCTTTCTGAGAAGGG - Intronic
1078542381 11:12222476-12222498 GAGTCAGGTATTTCAGGGAAGGG + Intronic
1080556316 11:33420648-33420670 CAGCAGGGAAGTTCAGAGAATGG + Intergenic
1080643165 11:34169789-34169811 CAGGAAGGGATTCCAGGGAAAGG - Intronic
1081552488 11:44126927-44126949 CAGTCAAGAACTTCAGAGAAAGG - Exonic
1083723307 11:64614528-64614550 CAGCCAGGGACCCCAGACAAAGG + Intronic
1084944919 11:72633217-72633239 CAGCCAGGGAGGTCAGGGGAGGG + Intronic
1085399265 11:76225749-76225771 CAGACAGGTATTCCAGATAATGG - Intergenic
1085428269 11:76424057-76424079 GAGCCAGGCATTTCAGAAAATGG - Intergenic
1087466725 11:98517322-98517344 CAGATAGTGGTTTCAGAGAAAGG - Intergenic
1088908975 11:114176296-114176318 AAGCCAGGGATATAAGAGTAAGG - Intronic
1089660790 11:119983682-119983704 CATCCAGGCTTGTCAGAGAAGGG + Intergenic
1090928635 11:131275690-131275712 CAGGGAAGGATTTCAGGGAAGGG - Intergenic
1092885752 12:12923149-12923171 CCGCCAGGTTTGTCAGAGAAAGG - Intergenic
1093432811 12:19103550-19103572 TAGCCAGGGAGATTAGAGAATGG - Intergenic
1094001304 12:25697923-25697945 CAGGAATGGATTTCAGTGAAAGG - Intergenic
1097604522 12:61736088-61736110 AAGCCAGGGATTGCTGAGAAGGG - Intronic
1098462854 12:70752002-70752024 TTGCCAGAGATTTCAGAGAAAGG - Intronic
1099381275 12:81955982-81956004 CAGCCAGGGGTTCCAGTGGAGGG - Intergenic
1100623310 12:96302904-96302926 CAGGCAGAGAATTCAGACAAAGG + Intronic
1100862775 12:98824188-98824210 AAGCCAGGGAAAGCAGAGAATGG - Intronic
1101250261 12:102927115-102927137 CAGCCATTGATAACAGAGAAAGG + Intronic
1101552218 12:105773585-105773607 CTGGCAGGGATTCCAGAGGAGGG - Intergenic
1102402911 12:112646441-112646463 CTGCCAGGGTTTTTAGAGAAAGG - Intronic
1102493585 12:113304208-113304230 CAGCCAGGGACTTAAGTGATGGG + Intronic
1102609690 12:114100624-114100646 AAGCCAGGAAATTCACAGAAGGG - Intergenic
1102976932 12:117213503-117213525 CTGCCAGGGATGGCAGAGCAAGG + Exonic
1104384600 12:128339373-128339395 GAGTCAGGAAGTTCAGAGAAAGG + Intronic
1104733503 12:131122067-131122089 CAGCCAGGGCCCTCAGAGACAGG - Intronic
1108185173 13:47881430-47881452 CAGCCAGGACTTTAAGAGGATGG - Intergenic
1108305326 13:49126154-49126176 CAGCCAGTAACTTCAGAGGAAGG - Intronic
1110362986 13:74648934-74648956 TAGCCAGGTACTTCATAGAAAGG - Intergenic
1111281369 13:86029388-86029410 TAGGGAGGGATTTCAGAGTAAGG - Intergenic
1111560134 13:89933883-89933905 CAGCCAGGTATTTTTGAGCAAGG + Intergenic
1113136608 13:107097236-107097258 AAGACAGACATTTCAGAGAATGG - Intergenic
1113791955 13:113033673-113033695 CAGCCAGAGATGGCAGACAAGGG - Intronic
1115741607 14:36394832-36394854 CAGCCAAGGCTTTCAGTGAAAGG - Intergenic
1115876311 14:37865663-37865685 TCTCCAGGGATTTCAGAGTAAGG + Intronic
1117521555 14:56556709-56556731 CTGCCAGGGATTTGAGACGAGGG - Intronic
1117782848 14:59252622-59252644 CACACAGGAATGTCAGAGAAAGG + Intronic
1118061628 14:62144938-62144960 GAGCCAGGCATTGGAGAGAAAGG - Intergenic
1118922631 14:70163836-70163858 CATCCAGGGATCTCACTGAAGGG - Intronic
1119890468 14:78178624-78178646 CAGCGTGAGATTTCAGTGAAAGG + Intergenic
1119937268 14:78603347-78603369 CAGCCCAGGATTTCAGTTAAAGG - Intronic
1121948726 14:98149854-98149876 GAGCCAGGGAATTCATAGAGAGG - Intergenic
1123869085 15:24553307-24553329 AAGCCAGGGGTTTGAGAAAAGGG - Intergenic
1123976607 15:25559795-25559817 CAGCCGGTGATTTCAGAGCCAGG - Intergenic
1124136493 15:27040093-27040115 CAGCACGGGATGGCAGAGAAGGG + Intronic
1124723994 15:32138695-32138717 CTGCCATGGATTGCAGAGAGAGG - Intronic
1124856529 15:33394641-33394663 CAGCCAAGAATCTCATAGAATGG - Intronic
1125989162 15:44088833-44088855 CAGCCAGTGATGTCAGAGATGGG + Intronic
1126417043 15:48428429-48428451 AAGCCAGGGATCTGTGAGAATGG - Exonic
1128136105 15:65264816-65264838 CTGCCTGGGTTTTCAGTGAAGGG - Intronic
1130025722 15:80268986-80269008 CAGGCTGGGATTGCAGGGAAGGG + Intergenic
1130145696 15:81272288-81272310 CGGCCAGTGAGTTCACAGAATGG - Intronic
1133079992 16:3310986-3311008 CAGCGAAGGTTTTCAGAGAATGG - Intronic
1133165764 16:3946208-3946230 CAGCCAGGGTTCTCTGAAAAAGG + Intergenic
1133205610 16:4231567-4231589 CAGCCTGAGAGTGCAGAGAAAGG - Intronic
1133206847 16:4239182-4239204 CAGCCAGGGGTGGGAGAGAAAGG + Intronic
1134195777 16:12157805-12157827 CACAAAGGGCTTTCAGAGAATGG - Intronic
1134766141 16:16759749-16759771 CAAGCAGGGATGGCAGAGAAGGG + Intergenic
1135167513 16:20153225-20153247 CAGCCATGGAGATGAGAGAAAGG + Intergenic
1135172322 16:20196479-20196501 CAGCCAGATATTTCTGAAAAGGG - Intergenic
1135351200 16:21730599-21730621 CTGCCAGAGATACCAGAGAAAGG + Intronic
1135419217 16:22293596-22293618 CAGCCATGGATTGAAGACAAAGG - Intergenic
1136223349 16:28843078-28843100 CAGCCAATGATCTTAGAGAAAGG - Exonic
1137348547 16:47688591-47688613 AAGCTTGAGATTTCAGAGAAAGG + Intronic
1137701312 16:50500039-50500061 CAGGCTGGCTTTTCAGAGAATGG + Intergenic
1138548099 16:57731276-57731298 CAGCCAGAGCTGCCAGAGAAAGG + Exonic
1138584636 16:57962083-57962105 GAGCCAGGGAGCTCCGAGAAGGG - Intronic
1138718630 16:59052933-59052955 CAGATGGGGACTTCAGAGAATGG + Intergenic
1138729234 16:59176437-59176459 AAGCCAGTGATTGGAGAGAAAGG - Intergenic
1143314690 17:6023437-6023459 CAGCCAGGGAGTTAAGAGATAGG + Intronic
1143341747 17:6216416-6216438 CAGTCATGGTTTTCATAGAAAGG - Intergenic
1145106742 17:20124116-20124138 GAGCCAGGGATGTCAGGGAATGG + Intronic
1145722062 17:27082793-27082815 CAGCCAGTGATCTTAGAGAAAGG - Intergenic
1146675410 17:34770191-34770213 CATACAGTGATTTAAGAGAAGGG - Intergenic
1147167804 17:38602737-38602759 CAGGCAGGGAGTTCAGGGGAAGG - Intronic
1148720421 17:49748681-49748703 CAGGTAGGCATTTCAGATAAAGG + Intronic
1151940377 17:77288131-77288153 CGGCCTGGGGTTTCAGAGAAGGG + Intronic
1155360092 18:24991234-24991256 CAGCCAGGGTTTTCAGGGCTTGG - Intergenic
1156687850 18:39671530-39671552 TAGCCTGGGATTTCTAAGAAAGG + Intergenic
1156888742 18:42165647-42165669 CAGCCAGGCATGGCAGAGACTGG + Intergenic
1157089264 18:44616694-44616716 CAGCCAGTGCTCTTAGAGAAAGG - Intergenic
1157424599 18:47573961-47573983 CAGCCAGGTATGTCAGAGCCTGG + Intergenic
1157719825 18:49915072-49915094 CAGCCATGGGTCTCAGAGAAGGG + Intronic
1157966027 18:52209255-52209277 GAGCCAAGGAATTCAGAGATGGG - Intergenic
1161066854 19:2242946-2242968 CAGAGAGGGAATTCAGAGGAAGG + Intronic
1161578285 19:5066861-5066883 CAGCCAGGGCTTTGAGAACACGG + Intronic
1161751825 19:6103531-6103553 GAGCCAGTGATAACAGAGAAGGG + Intronic
1163431961 19:17273510-17273532 CATGCAGGGTTTTCAGAGGAGGG + Intronic
1164534804 19:29077424-29077446 CAGCCAGAGCTTGCAGAAAAGGG + Intergenic
1165086458 19:33351491-33351513 CTGCCAGAGGTTTCAGAGTAGGG - Intergenic
1165171536 19:33895256-33895278 CAGCCAGGCATTTCTGGCAAGGG - Intergenic
1166272293 19:41721852-41721874 CAGCCAGTGACTTCAGAGCCAGG - Intronic
1166277311 19:41762919-41762941 CAGCCAGTGACTTCAGAGCCAGG - Intronic
1166424424 19:42663063-42663085 CAGCCAGTGACTTCAGAGCCAGG - Intronic
1166463718 19:43014420-43014442 CAGCCAGTGACTTCAGAGCCAGG + Intronic
1167744314 19:51341701-51341723 GAACCAGGGGTTTCAGAGAAGGG + Exonic
1168470598 19:56637774-56637796 CAGAAAGGAAATTCAGAGAAAGG - Intergenic
925352023 2:3208006-3208028 TAGCCAGGGATTTCAGACAATGG - Intronic
925952901 2:8932023-8932045 CTGCCAGGCATTTTAGTGAAAGG - Intronic
926301035 2:11602612-11602634 CAGCCAGGGAATTCCAGGAAGGG + Intronic
927403846 2:22745725-22745747 TGTCCAGAGATTTCAGAGAAAGG + Intergenic
928027051 2:27749010-27749032 CACTGAGGGATTTCAAAGAAAGG + Intergenic
928027068 2:27749114-27749136 CAGTGAGGGATTTCAAAGGAAGG + Intergenic
928360138 2:30655990-30656012 CTGCCTGGAATTTCAGAGATAGG - Intergenic
929136106 2:38625249-38625271 CAGACAGGGACTCCAGAGAGCGG + Intergenic
930542276 2:52721563-52721585 GAGCCAGGGATTCTATAGAATGG + Intergenic
935444266 2:103139674-103139696 CACCCAGGGCTCTCAGAGTAGGG + Intergenic
937196373 2:120160811-120160833 CAGGCAGGATTTTCAAAGAAAGG - Intronic
937248046 2:120506174-120506196 CAGTCAGGGGTATCAGGGAAGGG - Intergenic
938094566 2:128453018-128453040 CAGCCAGCCACGTCAGAGAAGGG - Intergenic
938250535 2:129812563-129812585 CAATCTGGGATTTCAGAAAATGG + Intergenic
939037930 2:137155432-137155454 CAGGCAGTAGTTTCAGAGAAAGG + Intronic
939875385 2:147571793-147571815 CAGGAAGGGATTTTTGAGAAGGG - Intergenic
943688726 2:190846862-190846884 CAGCGAGGCATATCAGAGATTGG + Intergenic
945018607 2:205547866-205547888 CTGCAAGGGAATCCAGAGAAAGG + Intronic
945633437 2:212315092-212315114 TAGGCAAGGATTTCAGAAAATGG + Intronic
946679913 2:222202495-222202517 CAGACTGGAATTTCAAAGAAGGG + Intronic
946823871 2:223656770-223656792 CAGACAGGGAACTCAGAGAGAGG - Intergenic
946966081 2:225039845-225039867 AAGACAGGGATTTCAGAAAGGGG + Intronic
948846986 2:240687892-240687914 CTGTCTGGCATTTCAGAGAAGGG + Intergenic
949046170 2:241873567-241873589 GAGGCAGGGGTCTCAGAGAAAGG - Exonic
1169267547 20:4175829-4175851 TTGCCAGGGATCTCAGAGAATGG + Intronic
1170057622 20:12224158-12224180 CAGTGAGGTATTACAGAGAATGG + Intergenic
1172009544 20:31838406-31838428 CAGCCAGGGAGGTCAGTGAATGG + Intergenic
1173852203 20:46226202-46226224 CAGACCAAGATTTCAGAGAAGGG - Intronic
1173997031 20:47346319-47346341 CCACCAGGGACTTCAGAGCAAGG - Intronic
1174336827 20:49868377-49868399 CACGCAGGGTTTTCAGAGAGGGG + Intronic
1175158977 20:56994089-56994111 CTGCCAGGGAGGTCAGAGAGGGG - Intergenic
1175441652 20:58996453-58996475 CAGCCGCGCATGTCAGAGAAGGG + Intronic
1176018794 20:62952453-62952475 CAGACTGGGGCTTCAGAGAAGGG - Intergenic
1176137311 20:63529916-63529938 CAGCCTGGGTGCTCAGAGAATGG + Intronic
1178000284 21:28154445-28154467 CAGACAGGACTCTCAGAGAAGGG - Intergenic
1178541983 21:33459774-33459796 GCCCCAGGGATTTCAGATAAGGG - Intronic
1180084677 21:45502655-45502677 CAAGCAGGGATTTCAGCAAAGGG + Intronic
949681286 3:6517327-6517349 ATGCCAGGGATGACAGAGAAAGG + Intergenic
949788906 3:7771618-7771640 TTGCCAAGGATCTCAGAGAAGGG - Intergenic
950410448 3:12832928-12832950 GCTCCAGGGGTTTCAGAGAAGGG + Intronic
950482855 3:13255270-13255292 CAGCCAGGGGTTCCTGAGGACGG + Intergenic
950542586 3:13621127-13621149 CTGCCAGGGCTTCCAGAGGAGGG - Intronic
950628026 3:14262623-14262645 CCACCAGGGATTGCAGAGATTGG + Intergenic
951890246 3:27561631-27561653 CAGCCAGAAATTTGAGAGAAAGG + Intergenic
953012323 3:39039239-39039261 AAGCCCAGAATTTCAGAGAATGG + Intergenic
953062058 3:39435407-39435429 GTGGCAGGGATTTCTGAGAAGGG + Intergenic
953384258 3:42497350-42497372 CAGCCAGGGGTCTGAGAGCAGGG - Intronic
953589458 3:44237564-44237586 CAGGCATGTACTTCAGAGAATGG + Intergenic
954902560 3:54032201-54032223 CAGGAAGGGATTTCAGGAAATGG + Intergenic
955207515 3:56909863-56909885 AAGCCATGGATGTCAGGGAAAGG - Intronic
955233027 3:57115624-57115646 CAGGCTGCGACTTCAGAGAATGG + Intronic
955832035 3:63015257-63015279 AGGTCAGAGATTTCAGAGAAAGG - Intergenic
956048992 3:65226962-65226984 CAGCTAGGGATTTGTGAGCAGGG - Intergenic
957378118 3:79386961-79386983 CAGCCAGGGATATGTCAGAATGG + Intronic
960003894 3:112762339-112762361 GAGCCAGGCGTTTCAGAGAAAGG + Intronic
964761875 3:160142046-160142068 CAGCCAGGGAAATTAGAAAAGGG - Intergenic
964843479 3:161020441-161020463 CAGAGAAGCATTTCAGAGAAGGG + Intronic
965216199 3:165868115-165868137 CCTCCAGGGAGTTCAGTGAAGGG - Intergenic
966479922 3:180395881-180395903 CAGCCTAGAATATCAGAGAAAGG - Intergenic
968076847 3:195820660-195820682 CAGCCCGGGAATGCGGAGAATGG - Intergenic
968854408 4:3108538-3108560 CAGCCAGAGATATCACAGAGGGG - Intronic
969186694 4:5479670-5479692 CTTCCAGGGATTCTAGAGAAGGG + Intronic
969527902 4:7713362-7713384 AAGCCTGGGATTTCAGAGTGTGG + Intronic
969685244 4:8669008-8669030 CAACAACGGATTTCAAAGAATGG + Intergenic
969851203 4:9957826-9957848 CTGCAAGGAGTTTCAGAGAAAGG + Intronic
970345204 4:15146466-15146488 CAGCCAGGGATGTTTCAGAAAGG - Intergenic
970774960 4:19662492-19662514 CAGACAGGGATTCCAGATAATGG + Intergenic
971223481 4:24730623-24730645 CAGACAGGGATTAGAGAGGATGG - Intergenic
972602690 4:40586905-40586927 CTGCCAAGCATTTCAGACAACGG + Intronic
972835368 4:42863761-42863783 CAGCCAGATATTTGAGAGAAAGG + Intergenic
973657895 4:53069140-53069162 CCGCTAGGGAATCCAGAGAAGGG + Intronic
976853632 4:89577412-89577434 CAGGCAGGGCTGTCTGAGAAAGG + Intergenic
977372418 4:96155998-96156020 CATTCAGGGATTTTAAAGAAAGG + Intergenic
977413035 4:96691995-96692017 AAGCCAGGGATTTAATAGAATGG + Intergenic
979271167 4:118763977-118763999 CAGCCAGGCATTACAGAATAGGG + Intronic
981569901 4:146140493-146140515 AAGCCAGGGTTTTCTTAGAAAGG - Intergenic
982147588 4:152413862-152413884 AAAACAGTGATTTCAGAGAAAGG + Intronic
982401347 4:154971487-154971509 CAGCTAGGTATTTCAATGAAAGG - Intergenic
983251927 4:165355252-165355274 GAGGCAGAGATTTCAGTGAACGG - Intergenic
984895979 4:184540297-184540319 AACCCAGGAAATTCAGAGAAGGG + Intergenic
987276320 5:16366676-16366698 CAGCCAGGAATATCTGAAAATGG - Intergenic
987375319 5:17228854-17228876 TAGCCAGGAATCTCAGAAAAAGG + Intronic
987548795 5:19351279-19351301 TAGGCAGGAATTTCACAGAAGGG - Intergenic
988564248 5:32308356-32308378 CACCAAGGCAGTTCAGAGAAAGG + Intronic
989348136 5:40453287-40453309 CAGCCAGAGATCCCAGAGGAAGG - Intergenic
991001166 5:61784515-61784537 CTGCCAGGGAGTTCTGTGAACGG - Intergenic
992995912 5:82332621-82332643 CAGCCAGGCAGATCAGAGACAGG + Intronic
994276053 5:97839216-97839238 CAGGCAGGGTTTTAAGAGAAAGG + Intergenic
995086550 5:108117746-108117768 AGGCCAGGGATTTCCGAGAGGGG - Intronic
995218131 5:109618496-109618518 CAGCCAGAGAATTGAGAGGATGG + Intergenic
995390564 5:111636131-111636153 CAGTAAGATATTTCAGAGAAAGG - Intergenic
997013719 5:129905972-129905994 CAGCAGGGGCTTTCAGAGGAGGG - Intronic
997500651 5:134371151-134371173 GGGCCAGAGATTTCAGGGAAAGG - Intergenic
997613699 5:135232130-135232152 CAGGAAGGGTTCTCAGAGAAAGG + Intronic
998894622 5:146786462-146786484 CAGCCAGGGGTTTCAGGAAGTGG - Intronic
998955789 5:147436958-147436980 TGGCCTGGGATTTAAGAGAAAGG + Intronic
1001079915 5:168660154-168660176 CACCCAGGTATTTCAGGGAAAGG + Intergenic
1002290931 5:178200210-178200232 CAGCCAGGGTTTTCACACAGAGG + Intergenic
1002355605 5:178626732-178626754 CGGCCAGGGCCCTCAGAGAAGGG + Intronic
1002842592 6:919182-919204 CATCCAAGGATTCCAGAGAGGGG + Intergenic
1002876025 6:1209976-1209998 CGGGCAGAGATTTCAGACAAAGG + Intergenic
1003334631 6:5159058-5159080 AAGCCATGGATTTCGGGGAAAGG + Intronic
1004263098 6:14125384-14125406 CTCCCAGGCATTTCAGATAAAGG - Intronic
1004997488 6:21207864-21207886 CAGCCATAGATTTCTGACAATGG + Intronic
1005248742 6:23919212-23919234 GAGCCATGGAGTTTAGAGAATGG - Intergenic
1005717078 6:28559603-28559625 AAGACAAGGATTTCTGAGAAGGG + Intergenic
1007428204 6:41760627-41760649 GAGCCAGAGATTGCAGAGCAGGG - Intergenic
1007811176 6:44486814-44486836 CAGAGAGAGATTCCAGAGAAGGG - Intergenic
1007820586 6:44557997-44558019 CAGCCACGGGTTTCTGAGGAAGG + Intergenic
1007881641 6:45174819-45174841 CAGATAGGTATTTCAAAGAATGG - Intronic
1010987472 6:82441258-82441280 CAGCATGGTATTACAGAGAAAGG - Intergenic
1011546960 6:88491907-88491929 CAGCCAGTGAAATCAGAGAATGG - Intergenic
1011630709 6:89321227-89321249 CAGACAGGGATATGGGAGAAAGG + Intergenic
1012158847 6:95857107-95857129 CAGACAGAGATTTCAGCAAAGGG - Intergenic
1013228424 6:108138544-108138566 CAGCCAGAGGTTTCTGGGAAAGG + Intronic
1014910846 6:127091230-127091252 CTGTCTGGGATTGCAGAGAAAGG - Intergenic
1015748513 6:136536588-136536610 CAGCAAGAAATTTAAGAGAAAGG - Intronic
1017410197 6:154159963-154159985 CAGCCAGGAAATACAGAGAGTGG - Exonic
1018037468 6:159893541-159893563 GAGCCAGGTTTCTCAGAGAAGGG + Intergenic
1018198670 6:161376523-161376545 CGGCCAGGGAATACAGAGGAGGG - Intronic
1018685016 6:166297711-166297733 GAGACAGGGACTTCAGACAAAGG - Intergenic
1019406527 7:887002-887024 CAGCCAGGCAGCTCACAGAAGGG - Intronic
1019701733 7:2477553-2477575 CTGCCAGGGCTTGGAGAGAATGG - Intergenic
1020194307 7:6025557-6025579 CAGTCAGGGAACTCTGAGAATGG + Intronic
1020222488 7:6250665-6250687 CTGCCAGGGGTTGCAGAGGAGGG + Intronic
1020945835 7:14604766-14604788 CAGTCATTGAGTTCAGAGAAAGG + Intronic
1021360019 7:19701358-19701380 TTGCCAGGGATTACAGGGAACGG + Intronic
1021606077 7:22410899-22410921 AAGGCAGGGAGTGCAGAGAAGGG + Intergenic
1022241301 7:28515282-28515304 CACCCAGAGAGGTCAGAGAAAGG - Intronic
1022509520 7:30926212-30926234 CAGCCAGGCATTCCACAGAGGGG - Intergenic
1023062268 7:36339531-36339553 GTGAGAGGGATTTCAGAGAAGGG + Intronic
1023267370 7:38421165-38421187 CAGCCATGGATGACAGGGAAAGG + Intronic
1023395026 7:39744528-39744550 CAGCCAAGGTTTGCAGAGCAAGG + Intergenic
1024009946 7:45258973-45258995 CAGCCAGGGATGGGAGAGGATGG + Intergenic
1024393137 7:48837752-48837774 CATACAGAGATTTCAGAGGAAGG - Intergenic
1027499787 7:78934774-78934796 CTCCCAGGCATTTCAGATAAGGG + Intronic
1029135040 7:98364212-98364234 CAGCCAGGCTTTACTGAGAAAGG - Intronic
1029556778 7:101275862-101275884 GAGCCACGGGTTTCTGAGAAGGG + Intergenic
1029610851 7:101625856-101625878 CAGCCAGGTGTGCCAGAGAAAGG - Intronic
1032998824 7:137480375-137480397 GAGGAAGAGATTTCAGAGAAAGG + Intronic
1033230997 7:139597234-139597256 CAGCCAGGGCTTTCGGAGCAGGG + Intronic
1033496843 7:141907583-141907605 CAGTAAGGGTTCTCAGAGAAAGG + Intergenic
1035252535 7:157606446-157606468 CAGCCAGGGATGGCAGTGACAGG - Intronic
1036834684 8:12051611-12051633 CAATCAGGGATATCAAAGAAGGG + Intergenic
1036856527 8:12298175-12298197 CAATCAGGGATATCAAAGAAGGG + Intergenic
1036924572 8:12892029-12892051 ACCCCTGGGATTTCAGAGAATGG + Intergenic
1037762380 8:21750501-21750523 CACCCAAGGAATGCAGAGAAAGG + Intronic
1038221811 8:25615636-25615658 CAGGAAGGGATTTCAGATAAAGG + Intergenic
1038975020 8:32685783-32685805 CCAACAGGGATTTGAGAGAAAGG + Intronic
1039884952 8:41649453-41649475 CAGCCAAGGTTTTCAGAGGGTGG - Intronic
1040667026 8:49646174-49646196 GAGCCAAGGTTTTCAGAGAGAGG - Intergenic
1041764956 8:61409425-61409447 CAGCATAGTATTTCAGAGAATGG + Intronic
1041792817 8:61715246-61715268 CAGCCAGGGATTTCAGACAGAGG - Intergenic
1041857586 8:62476097-62476119 TAGCTAGGGATTTCAGATGAGGG + Intronic
1041966517 8:63684544-63684566 CAGGCAGGGATTTCAGAACCTGG + Intergenic
1043874190 8:85465360-85465382 CAGACAGGGGCTTCAGGGAAGGG - Exonic
1045344886 8:101284981-101285003 TAGGCAGAGATTTCAGAGATTGG - Intergenic
1047099782 8:121664256-121664278 CAGCCTGGCATTTTAGAGATGGG - Intergenic
1047917389 8:129596508-129596530 CAGTCAGTGAGTTCAGAGGAAGG - Intergenic
1048257875 8:132919117-132919139 CAGACAGGGATTTCAAATAGGGG - Intronic
1051496854 9:17732946-17732968 CAGCCAGGTGTTACAGAGAGAGG - Intronic
1052542889 9:29833984-29834006 AAGCCAGGGATCCCAGAGGAAGG + Intergenic
1052769123 9:32671427-32671449 CTTCCAGGGATTACAGTGAAAGG + Intergenic
1053025267 9:34724051-34724073 CAGCCAGGGACCACAGAGAAGGG - Exonic
1053036795 9:34833113-34833135 CAGCCAGGGACTACAGAGAAGGG - Intergenic
1053445454 9:38149855-38149877 GAGCCAGTGATTGCAGAGACAGG - Intergenic
1055120029 9:72649110-72649132 AAGTCAGGGATAGCAGAGAAAGG + Intronic
1056743237 9:89278171-89278193 CACACAAGGACTTCAGAGAATGG - Intergenic
1057370236 9:94464939-94464961 CAGACAGAGATTTCAGACAGAGG + Intergenic
1059453419 9:114385216-114385238 CTGGCAGGGATTTCCAAGAAGGG - Intronic
1059908744 9:119019326-119019348 CATCCAGGGTTTTGGGAGAAGGG + Intergenic
1059974995 9:119706629-119706651 CAGTCAGAGATATCAGAGATAGG - Intergenic
1060147441 9:121265116-121265138 GAGACAGGGATTTCATACAAGGG - Intronic
1060504567 9:124188259-124188281 CAGCCTGGGGAATCAGAGAATGG - Intergenic
1061368156 9:130183154-130183176 CAGCCAGGGAGTTGAGAGTTGGG + Intronic
1061684525 9:132264350-132264372 AGGCCAGGGCTTTCAGTGAAGGG - Exonic
1062462821 9:136668986-136669008 CAGCCAGGGATGCCAGGGTAGGG - Intronic
1186275234 X:7931014-7931036 CCACCATGGAGTTCAGAGAAAGG + Intergenic
1186663905 X:11699218-11699240 GAGCCAGGTTTTTCAGAAAAAGG - Intergenic
1187800946 X:23061894-23061916 TATGCAGGGATTTCAAAGAAAGG + Intergenic
1190115965 X:47626563-47626585 CAGCAAGGGGGTTCAGAGGAAGG + Intronic
1191594442 X:62926987-62927009 TAGCCAATGATTACAGAGAAAGG - Intergenic
1192142700 X:68659318-68659340 CAGCCAGGGAATGAAGGGAATGG - Intronic
1193484594 X:82071196-82071218 TAGTCCAGGATTTCAGAGAAAGG - Intergenic
1194188557 X:90807199-90807221 GAGGCAGAGATTACAGAGAAAGG - Intergenic
1195959984 X:110376366-110376388 CAGACAGGGATGTCAGAGTGAGG + Intronic
1198152485 X:133924600-133924622 CAGCCACCTATTTGAGAGAAAGG + Intronic
1200535146 Y:4389094-4389116 GAGACAGAGATTACAGAGAAAGG - Intergenic
1200876520 Y:8161321-8161343 AAGCCAGGGATGTTACAGAAAGG - Intergenic
1200932178 Y:8706955-8706977 CTGTCAGGAATTTCAGAGAGTGG - Intergenic
1200961843 Y:9003097-9003119 CTGCCAGAGATTTCAGAGAGAGG + Intergenic
1201447717 Y:14076519-14076541 CCACCATGGAATTCAGAGAAAGG - Intergenic
1202272958 Y:23088099-23088121 CAGCCAGGGCTTTCTGAGGCTGG + Intergenic
1202293068 Y:23332583-23332605 CAGCCAGGGCTTTCTGAGGCTGG - Intergenic
1202425955 Y:24721843-24721865 CAGCCAGGGCTTTCTGAGGCTGG + Intergenic
1202444834 Y:24948243-24948265 CAGCCAGGGCTTTCTGAGGCTGG - Intergenic