ID: 1064904338

View in Genome Browser
Species Human (GRCh38)
Location 10:20329505-20329527
Sequence CTTCTTGCTGTGTCATCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4177
Summary {0: 4, 1: 89, 2: 311, 3: 1232, 4: 2541}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064904338 Original CRISPR CTTCTTGCTGTGTCATCCTA TGG (reversed) Intergenic
Too many off-targets to display for this crispr