ID: 1064908106

View in Genome Browser
Species Human (GRCh38)
Location 10:20370016-20370038
Sequence TTACCACAGCTGATGCTCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064908106_1064908114 29 Left 1064908106 10:20370016-20370038 CCGGAGAGCATCAGCTGTGGTAA No data
Right 1064908114 10:20370068-20370090 CTTTAGAACTTCCAAGACAGAGG No data
1064908106_1064908111 5 Left 1064908106 10:20370016-20370038 CCGGAGAGCATCAGCTGTGGTAA No data
Right 1064908111 10:20370044-20370066 AGAGAAACCAGAGAGTGGGTGGG No data
1064908106_1064908109 1 Left 1064908106 10:20370016-20370038 CCGGAGAGCATCAGCTGTGGTAA No data
Right 1064908109 10:20370040-20370062 ATGGAGAGAAACCAGAGAGTGGG No data
1064908106_1064908108 0 Left 1064908106 10:20370016-20370038 CCGGAGAGCATCAGCTGTGGTAA No data
Right 1064908108 10:20370039-20370061 CATGGAGAGAAACCAGAGAGTGG No data
1064908106_1064908110 4 Left 1064908106 10:20370016-20370038 CCGGAGAGCATCAGCTGTGGTAA No data
Right 1064908110 10:20370043-20370065 GAGAGAAACCAGAGAGTGGGTGG No data
1064908106_1064908112 6 Left 1064908106 10:20370016-20370038 CCGGAGAGCATCAGCTGTGGTAA No data
Right 1064908112 10:20370045-20370067 GAGAAACCAGAGAGTGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064908106 Original CRISPR TTACCACAGCTGATGCTCTC CGG (reversed) Intergenic
No off target data available for this crispr