ID: 1064910168

View in Genome Browser
Species Human (GRCh38)
Location 10:20392556-20392578
Sequence AGGTGGTTCTGGCTGTCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064910166_1064910168 -7 Left 1064910166 10:20392540-20392562 CCTTACACGGCTGGCAAGGTGGT No data
Right 1064910168 10:20392556-20392578 AGGTGGTTCTGGCTGTCAGATGG No data
1064910162_1064910168 5 Left 1064910162 10:20392528-20392550 CCAAGAAGATTTCCTTACACGGC No data
Right 1064910168 10:20392556-20392578 AGGTGGTTCTGGCTGTCAGATGG No data
1064910160_1064910168 18 Left 1064910160 10:20392515-20392537 CCTCTATCTTTTTCCAAGAAGAT No data
Right 1064910168 10:20392556-20392578 AGGTGGTTCTGGCTGTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064910168 Original CRISPR AGGTGGTTCTGGCTGTCAGA TGG Intergenic
No off target data available for this crispr