ID: 1064912425

View in Genome Browser
Species Human (GRCh38)
Location 10:20416985-20417007
Sequence AAATTTCAACATATGAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064912425_1064912430 1 Left 1064912425 10:20416985-20417007 CCCCCATTCATATGTTGAAATTT No data
Right 1064912430 10:20417009-20417031 ATCACCAATGTAATGGTACTAGG No data
1064912425_1064912436 17 Left 1064912425 10:20416985-20417007 CCCCCATTCATATGTTGAAATTT No data
Right 1064912436 10:20417025-20417047 TACTAGGAAATGGGGCTCTTGGG No data
1064912425_1064912429 -6 Left 1064912425 10:20416985-20417007 CCCCCATTCATATGTTGAAATTT No data
Right 1064912429 10:20417002-20417024 AAATTTAATCACCAATGTAATGG No data
1064912425_1064912434 9 Left 1064912425 10:20416985-20417007 CCCCCATTCATATGTTGAAATTT No data
Right 1064912434 10:20417017-20417039 TGTAATGGTACTAGGAAATGGGG No data
1064912425_1064912435 16 Left 1064912425 10:20416985-20417007 CCCCCATTCATATGTTGAAATTT No data
Right 1064912435 10:20417024-20417046 GTACTAGGAAATGGGGCTCTTGG No data
1064912425_1064912432 7 Left 1064912425 10:20416985-20417007 CCCCCATTCATATGTTGAAATTT No data
Right 1064912432 10:20417015-20417037 AATGTAATGGTACTAGGAAATGG No data
1064912425_1064912433 8 Left 1064912425 10:20416985-20417007 CCCCCATTCATATGTTGAAATTT No data
Right 1064912433 10:20417016-20417038 ATGTAATGGTACTAGGAAATGGG No data
1064912425_1064912437 20 Left 1064912425 10:20416985-20417007 CCCCCATTCATATGTTGAAATTT No data
Right 1064912437 10:20417028-20417050 TAGGAAATGGGGCTCTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064912425 Original CRISPR AAATTTCAACATATGAATGG GGG (reversed) Intergenic
No off target data available for this crispr