ID: 1064920586

View in Genome Browser
Species Human (GRCh38)
Location 10:20513098-20513120
Sequence TCTTACATTCATATATTGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064920585_1064920586 -7 Left 1064920585 10:20513082-20513104 CCAATGCAGGTTTCTTTCTTACA No data
Right 1064920586 10:20513098-20513120 TCTTACATTCATATATTGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064920586 Original CRISPR TCTTACATTCATATATTGCA CGG Intergenic
No off target data available for this crispr