ID: 1064924318

View in Genome Browser
Species Human (GRCh38)
Location 10:20553271-20553293
Sequence CTTCACACGTGTCCAAAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064924315_1064924318 12 Left 1064924315 10:20553236-20553258 CCACAATATGGCTACCACAGATC No data
Right 1064924318 10:20553271-20553293 CTTCACACGTGTCCAAAGAATGG No data
1064924317_1064924318 -10 Left 1064924317 10:20553258-20553280 CCAAGCATCACATCTTCACACGT No data
Right 1064924318 10:20553271-20553293 CTTCACACGTGTCCAAAGAATGG No data
1064924316_1064924318 -2 Left 1064924316 10:20553250-20553272 CCACAGATCCAAGCATCACATCT No data
Right 1064924318 10:20553271-20553293 CTTCACACGTGTCCAAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064924318 Original CRISPR CTTCACACGTGTCCAAAGAA TGG Intergenic
No off target data available for this crispr