ID: 1064927122

View in Genome Browser
Species Human (GRCh38)
Location 10:20581753-20581775
Sequence AATTCTATGCAGAAAAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064927112_1064927122 17 Left 1064927112 10:20581713-20581735 CCAACTTATGCTTCCTTTTGATA No data
Right 1064927122 10:20581753-20581775 AATTCTATGCAGAAAAGGGAGGG No data
1064927111_1064927122 18 Left 1064927111 10:20581712-20581734 CCCAACTTATGCTTCCTTTTGAT No data
Right 1064927122 10:20581753-20581775 AATTCTATGCAGAAAAGGGAGGG No data
1064927110_1064927122 19 Left 1064927110 10:20581711-20581733 CCCCAACTTATGCTTCCTTTTGA No data
Right 1064927122 10:20581753-20581775 AATTCTATGCAGAAAAGGGAGGG No data
1064927118_1064927122 4 Left 1064927118 10:20581726-20581748 CCTTTTGATAGGGACAGGGGACA No data
Right 1064927122 10:20581753-20581775 AATTCTATGCAGAAAAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064927122 Original CRISPR AATTCTATGCAGAAAAGGGA GGG Intergenic
No off target data available for this crispr