ID: 1064927916

View in Genome Browser
Species Human (GRCh38)
Location 10:20590454-20590476
Sequence CTTTGAGTAGATGAGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064927916_1064927920 -4 Left 1064927916 10:20590454-20590476 CCCACTTCCTCATCTACTCAAAG No data
Right 1064927920 10:20590473-20590495 AAAGCTTACCAATCATCAGTGGG No data
1064927916_1064927919 -5 Left 1064927916 10:20590454-20590476 CCCACTTCCTCATCTACTCAAAG No data
Right 1064927919 10:20590472-20590494 CAAAGCTTACCAATCATCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064927916 Original CRISPR CTTTGAGTAGATGAGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr