ID: 1064928770

View in Genome Browser
Species Human (GRCh38)
Location 10:20599971-20599993
Sequence CATCCAAGGCAGAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064928770_1064928775 2 Left 1064928770 10:20599971-20599993 CCTTCCACCTTCTGCCTTGGATG No data
Right 1064928775 10:20599996-20600018 ACAGCAGGAATGCCCTCACCAGG No data
1064928770_1064928778 16 Left 1064928770 10:20599971-20599993 CCTTCCACCTTCTGCCTTGGATG No data
Right 1064928778 10:20600010-20600032 CTCACCAGGTGTTGTCACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064928770 Original CRISPR CATCCAAGGCAGAAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr