ID: 1064931124

View in Genome Browser
Species Human (GRCh38)
Location 10:20628429-20628451
Sequence GAGGAGAGAAAGAGATTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064931120_1064931124 16 Left 1064931120 10:20628390-20628412 CCTGGAGATTCTTTCAGCATTGG No data
Right 1064931124 10:20628429-20628451 GAGGAGAGAAAGAGATTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064931124 Original CRISPR GAGGAGAGAAAGAGATTAAG AGG Intergenic
No off target data available for this crispr