ID: 1064933656

View in Genome Browser
Species Human (GRCh38)
Location 10:20655553-20655575
Sequence TCACCTTGGGTTGCTGCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064933653_1064933656 6 Left 1064933653 10:20655524-20655546 CCAAGCTTAATGTATTTTAATAG 0: 2
1: 0
2: 2
3: 40
4: 460
Right 1064933656 10:20655553-20655575 TCACCTTGGGTTGCTGCAAAAGG No data
1064933652_1064933656 13 Left 1064933652 10:20655517-20655539 CCAAAAACCAAGCTTAATGTATT 0: 2
1: 0
2: 2
3: 19
4: 218
Right 1064933656 10:20655553-20655575 TCACCTTGGGTTGCTGCAAAAGG No data
1064933651_1064933656 28 Left 1064933651 10:20655502-20655524 CCACTATCAAATTTTCCAAAAAC No data
Right 1064933656 10:20655553-20655575 TCACCTTGGGTTGCTGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064933656 Original CRISPR TCACCTTGGGTTGCTGCAAA AGG Intergenic
No off target data available for this crispr