ID: 1064936552

View in Genome Browser
Species Human (GRCh38)
Location 10:20684928-20684950
Sequence CCTGCCAGTTTTGGTTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064936552_1064936559 23 Left 1064936552 10:20684928-20684950 CCCACAAAACCAAAACTGGCAGG No data
Right 1064936559 10:20684974-20684996 AGACTTGCCCCAGTACTTGCTGG No data
1064936552_1064936560 24 Left 1064936552 10:20684928-20684950 CCCACAAAACCAAAACTGGCAGG No data
Right 1064936560 10:20684975-20684997 GACTTGCCCCAGTACTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064936552 Original CRISPR CCTGCCAGTTTTGGTTTTGT GGG (reversed) Intergenic
No off target data available for this crispr