ID: 1064937452

View in Genome Browser
Species Human (GRCh38)
Location 10:20693940-20693962
Sequence AGGCAAACTATAGACTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064937452_1064937456 21 Left 1064937452 10:20693940-20693962 CCATCACAGTCTATAGTTTGCCT No data
Right 1064937456 10:20693984-20694006 ACATGCCTGCTTCAGTACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064937452 Original CRISPR AGGCAAACTATAGACTGTGA TGG (reversed) Intergenic
No off target data available for this crispr