ID: 1064938199

View in Genome Browser
Species Human (GRCh38)
Location 10:20703916-20703938
Sequence TAGGAGCCACACCAGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064938199_1064938209 19 Left 1064938199 10:20703916-20703938 CCTGGCTCCTGGTGTGGCTCCTA No data
Right 1064938209 10:20703958-20703980 ACCCTAGGAATTGGAGATGTGGG No data
1064938199_1064938208 18 Left 1064938199 10:20703916-20703938 CCTGGCTCCTGGTGTGGCTCCTA No data
Right 1064938208 10:20703957-20703979 TACCCTAGGAATTGGAGATGTGG No data
1064938199_1064938207 10 Left 1064938199 10:20703916-20703938 CCTGGCTCCTGGTGTGGCTCCTA No data
Right 1064938207 10:20703949-20703971 AGTGCTCATACCCTAGGAATTGG No data
1064938199_1064938206 4 Left 1064938199 10:20703916-20703938 CCTGGCTCCTGGTGTGGCTCCTA No data
Right 1064938206 10:20703943-20703965 AAGGGCAGTGCTCATACCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064938199 Original CRISPR TAGGAGCCACACCAGGAGCC AGG (reversed) Intergenic
No off target data available for this crispr