ID: 1064941062

View in Genome Browser
Species Human (GRCh38)
Location 10:20736016-20736038
Sequence CTATATTCACATATATAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064941058_1064941062 28 Left 1064941058 10:20735965-20735987 CCTGTTATAGAATGGAAAAGAGA No data
Right 1064941062 10:20736016-20736038 CTATATTCACATATATAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064941062 Original CRISPR CTATATTCACATATATAGAA AGG Intergenic
No off target data available for this crispr