ID: 1064944264

View in Genome Browser
Species Human (GRCh38)
Location 10:20770680-20770702
Sequence ATGAAGAAACAGAACAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064944264_1064944267 -2 Left 1064944264 10:20770680-20770702 CCTTCCTTGTTCTGTTTCTTCAT No data
Right 1064944267 10:20770701-20770723 ATCTTTCACATGTCTTCCTTGGG No data
1064944264_1064944266 -3 Left 1064944264 10:20770680-20770702 CCTTCCTTGTTCTGTTTCTTCAT No data
Right 1064944266 10:20770700-20770722 CATCTTTCACATGTCTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064944264 Original CRISPR ATGAAGAAACAGAACAAGGA AGG (reversed) Intergenic
No off target data available for this crispr