ID: 1064944266

View in Genome Browser
Species Human (GRCh38)
Location 10:20770700-20770722
Sequence CATCTTTCACATGTCTTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064944264_1064944266 -3 Left 1064944264 10:20770680-20770702 CCTTCCTTGTTCTGTTTCTTCAT No data
Right 1064944266 10:20770700-20770722 CATCTTTCACATGTCTTCCTTGG No data
1064944263_1064944266 2 Left 1064944263 10:20770675-20770697 CCTCACCTTCCTTGTTCTGTTTC No data
Right 1064944266 10:20770700-20770722 CATCTTTCACATGTCTTCCTTGG No data
1064944265_1064944266 -7 Left 1064944265 10:20770684-20770706 CCTTGTTCTGTTTCTTCATCTTT No data
Right 1064944266 10:20770700-20770722 CATCTTTCACATGTCTTCCTTGG No data
1064944262_1064944266 9 Left 1064944262 10:20770668-20770690 CCAATTGCCTCACCTTCCTTGTT No data
Right 1064944266 10:20770700-20770722 CATCTTTCACATGTCTTCCTTGG No data
1064944261_1064944266 16 Left 1064944261 10:20770661-20770683 CCTTGAGCCAATTGCCTCACCTT No data
Right 1064944266 10:20770700-20770722 CATCTTTCACATGTCTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064944266 Original CRISPR CATCTTTCACATGTCTTCCT TGG Intergenic
No off target data available for this crispr