ID: 1064949308

View in Genome Browser
Species Human (GRCh38)
Location 10:20829753-20829775
Sequence TGCAGGAAATCTGACAGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064949306_1064949308 11 Left 1064949306 10:20829719-20829741 CCACACTAAAAAAAAATCTATGC 0: 1
1: 0
2: 3
3: 57
4: 466
Right 1064949308 10:20829753-20829775 TGCAGGAAATCTGACAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064949308 Original CRISPR TGCAGGAAATCTGACAGCTC AGG Intronic
No off target data available for this crispr