ID: 1064950873

View in Genome Browser
Species Human (GRCh38)
Location 10:20848722-20848744
Sequence CTGGCGAGTGGTGGTGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 570
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 519}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064950873_1064950880 15 Left 1064950873 10:20848722-20848744 CCAACACCACCACCACTCGCCAG 0: 1
1: 0
2: 1
3: 49
4: 519
Right 1064950880 10:20848760-20848782 TCTTCCATGAAACCCATCCCTGG 0: 7
1: 41
2: 507
3: 1075
4: 1627
1064950873_1064950884 30 Left 1064950873 10:20848722-20848744 CCAACACCACCACCACTCGCCAG 0: 1
1: 0
2: 1
3: 49
4: 519
Right 1064950884 10:20848775-20848797 ATCCCTGGTGCCAAAAAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064950873 Original CRISPR CTGGCGAGTGGTGGTGGTGT TGG (reversed) Intronic
900440304 1:2651700-2651722 TTGGAGAGGGGTGGTGCTGTAGG - Intronic
901363110 1:8721003-8721025 CTGGTGTGTGGTGGTGATCTCGG - Intronic
902308949 1:15565759-15565781 TTGGCGGGTGGAGGTGGTGGAGG - Intronic
902530797 1:17089513-17089535 CTGGCCAGGGGTGGTGGGGCAGG + Intronic
902649577 1:17827810-17827832 CAGGCTAGTGTTGGTGGGGTTGG - Intergenic
903013946 1:20349914-20349936 CTGGTCAGTGGTGGTGGTAGTGG + Intronic
903139016 1:21327428-21327450 CAGGCCAGTGGTAGTGGTGAGGG - Intronic
903273090 1:22204051-22204073 CTGGGGAATGGTTGTGGTGTGGG + Intergenic
903283631 1:22263975-22263997 CTGGGTGGTGGTGGTGGGGTGGG + Intergenic
903532148 1:24039221-24039243 TCTGAGAGTGGTGGTGGTGTTGG - Intergenic
904333061 1:29778002-29778024 CTGAAGAGTAGTGGTGGTGATGG - Intergenic
905364027 1:37439115-37439137 GTGGCAGGTGGTGGTGGTGGGGG - Intergenic
906608286 1:47185892-47185914 CTGGAGAGTGGTGAGGGGGTGGG - Intronic
907422998 1:54359821-54359843 CAGGCCAGTGGTGTTGCTGTGGG - Intronic
907475065 1:54700016-54700038 CTGGCTGGTGGTGAGGGTGTGGG + Intronic
907482427 1:54754452-54754474 GTGGCGAATGGTGAAGGTGTGGG + Intergenic
907850832 1:58253305-58253327 GTTGCCAGTGGTGGTGGGGTTGG - Intronic
907975321 1:59426158-59426180 CTGCCCAGAGGTGGTGGTGCTGG - Intronic
908319913 1:62969070-62969092 CTGGCGATTGGTGGTTGAGGAGG + Intergenic
908814147 1:68014242-68014264 CTGGAGGGTGGTGGTTGGGTGGG + Intergenic
908920100 1:69180018-69180040 CTGGCAATTGGTGGAAGTGTAGG - Intergenic
910186295 1:84544419-84544441 CTGGAGATGGGTGGTGGTGATGG + Intergenic
911173571 1:94796083-94796105 CTGGAGAGTGGTGGGGTGGTGGG - Intergenic
911390583 1:97236285-97236307 CTGGTGACTAGTGGTGGTGGAGG - Intronic
912068917 1:105782566-105782588 ATGGGTAGTGGTGGTGGGGTGGG - Intergenic
913217924 1:116636043-116636065 CTGGCGAGTGGAGGTGTACTGGG - Intronic
913689883 1:121269063-121269085 CAGGCCAGTGATGGTGGTGGTGG + Intronic
914147717 1:145011209-145011231 CAGGCCAGTGATGGTGGTGGTGG - Intronic
915367869 1:155325459-155325481 CTGGAGCGTGGTGGAGGCGTCGG + Exonic
915484672 1:156211988-156212010 ATGGGCAGTGGTGGTGGTGAAGG - Exonic
915603796 1:156938519-156938541 CTTCCTGGTGGTGGTGGTGTCGG - Intronic
915996096 1:160565420-160565442 GTAGCGCTTGGTGGTGGTGTAGG + Exonic
917611152 1:176690314-176690336 CTTGGGAGTGGGGGCGGTGTCGG - Exonic
917889077 1:179418668-179418690 CGGGAGGGAGGTGGTGGTGTCGG - Intronic
918018298 1:180659550-180659572 GTGGTGGGTGGTGGTGGTGGAGG - Intronic
919938101 1:202268243-202268265 CTGGCGGCTGGTGCTGGTGTGGG + Intronic
920477206 1:206287540-206287562 CAGGCCAGTGATGGTGGTGGTGG + Intronic
920498652 1:206472741-206472763 CTGGAGATTTGTGGTGGTGTGGG + Intronic
920543959 1:206800350-206800372 CAGGGCAGTGGTGGTGGGGTAGG + Intronic
921456794 1:215380751-215380773 GTGGCCTGTGGTGGTGGTGGTGG + Intergenic
922322461 1:224500762-224500784 CTGGCGACTGGGGTTGGTGCAGG - Intronic
922420019 1:225453168-225453190 CTGGAGAGGGATGGTGGTGATGG + Intergenic
922615659 1:226959992-226960014 TTGGTGCTTGGTGGTGGTGTTGG + Intronic
923203292 1:231733368-231733390 GTAGTGAGTGGTGGTGGTGATGG + Intronic
924174682 1:241378467-241378489 CTGGAGATTGGTGTTGGGGTTGG - Intergenic
924367173 1:243307273-243307295 CTGGGGAATGGTGGGGGTGGGGG - Intronic
924416249 1:243859756-243859778 CTTTCTAGTGGTGGTGGTGGTGG - Intergenic
1063375626 10:5552692-5552714 CTGGCGGGTGGTGGAGATGCAGG - Intergenic
1063478516 10:6349829-6349851 CTGGGAAGTGGAGGTGCTGTGGG + Intergenic
1064212279 10:13370148-13370170 CTGGAGATCGGTGGTGGTGATGG + Intergenic
1064425640 10:15226861-15226883 CTGGGGGGTGGTTGTGGTGGGGG - Intronic
1064445112 10:15386195-15386217 GTGGCAGGTGGTGGTGGTGGTGG + Intergenic
1064950873 10:20848722-20848744 CTGGCGAGTGGTGGTGGTGTTGG - Intronic
1065322154 10:24519980-24520002 CTTTCGTGTGGTGGTGGTGGAGG - Intronic
1065827041 10:29582121-29582143 CTGGAGAGGGATGGTGGTGATGG + Intronic
1065950809 10:30649061-30649083 CTGGAGAGGGATGGTGGTGATGG - Intergenic
1067022601 10:42814811-42814833 GTGGGGAGTGGTGGTTGTCTTGG + Intronic
1067665093 10:48270872-48270894 CAGGTCAGTGGTGGTGGGGTTGG - Intronic
1067687221 10:48473377-48473399 CTGGAGAGGGATGGTGGTGATGG + Intronic
1067691967 10:48507897-48507919 CTGGGGGGTGGGGGTGGGGTGGG + Intronic
1067957034 10:50803233-50803255 TTGGCCAGTTGTGGTGGCGTGGG - Exonic
1069572185 10:69500931-69500953 CTGGGTGGTGGTGGTGGTGGTGG + Intronic
1069613608 10:69792109-69792131 ATGGTGGGTGGTGGTGGTGGTGG - Intergenic
1069738836 10:70674693-70674715 CTGGAGTGTCGTGGTAGTGTGGG - Exonic
1070050770 10:72887403-72887425 CTGACGACTGGGGGTGGTGGAGG - Exonic
1071209207 10:83318018-83318040 GTGGCCTGTGGTGGTGGTGGTGG + Intergenic
1071597312 10:86937736-86937758 CTAGCAAGTGGTGGTCGTCTGGG - Intronic
1072022507 10:91416852-91416874 CTGGGGAGTGGTGGGGTGGTGGG - Intronic
1072890219 10:99316773-99316795 CTGGGTGGTGGTGGTGGTGCTGG + Intergenic
1073115811 10:101090937-101090959 CTGGGGTGTGGTGAGGGTGTGGG + Intronic
1073264168 10:102214580-102214602 CTGGCTAGGGGAGGTGGTGATGG + Intergenic
1073562474 10:104508742-104508764 CTGGAGATGGGTGGTGGTGATGG - Intergenic
1075604855 10:123797275-123797297 CTGGGTAGTGGCGGTGGGGTAGG - Intronic
1075922696 10:126226172-126226194 CTGGGGAAAGGTGGTGGTGGGGG + Intronic
1076086482 10:127636862-127636884 CTGGGCAGTGGGTGTGGTGTGGG + Intergenic
1076668879 10:132108308-132108330 CTGGCCAGAGGAGCTGGTGTGGG - Intronic
1076738430 10:132468814-132468836 CTGGACAGTGGTGGGGGTGTTGG + Intergenic
1077728837 11:4705967-4705989 GGGGCGGGTGGTGGTGGTGGTGG + Intronic
1079091940 11:17486899-17486921 CTGGAGATGGGTGGTGGTGATGG + Intergenic
1081653237 11:44839627-44839649 AAGGCAGGTGGTGGTGGTGTTGG - Intronic
1082164639 11:48930992-48931014 CTGGGGACTGGTTGTGGGGTGGG + Intergenic
1083713840 11:64564629-64564651 GTGGACAGTGGTGGTGCTGTTGG - Intronic
1084619157 11:70256881-70256903 AGGGAGAGTGGTGGTGGTGGGGG - Intergenic
1084953623 11:72679951-72679973 TTGGAGGGTGGTGGTGGTGAGGG - Intergenic
1085185019 11:74568556-74568578 CTGGGGAGGGGTGGGGGTGTGGG - Intronic
1085343107 11:75746582-75746604 CTGGAGATGGGTGGTGGTGATGG - Intergenic
1085722792 11:78928097-78928119 CTAGGGATGGGTGGTGGTGTTGG - Intronic
1087800712 11:102500883-102500905 CTGGAGATTGATGGTGGTGATGG - Intergenic
1089081261 11:115777929-115777951 GTGGCTGGTGGTGGTGGTGGGGG + Intergenic
1089135563 11:116246335-116246357 ATGGCTAGTTGTGGTGGTGACGG - Intergenic
1089190181 11:116648046-116648068 CTGGTGTGGGGTGTTGGTGTGGG - Intergenic
1089533573 11:119147912-119147934 CTGAGGAATGGTGGTGATGTGGG + Intergenic
1089595067 11:119573349-119573371 CTGGGGAGTGCTGGTGATTTCGG - Intergenic
1090204590 11:124877413-124877435 CAGGACAGTGGCGGTGGTGTTGG - Intronic
1091138225 11:133212146-133212168 GTTGTGATTGGTGGTGGTGTGGG - Intronic
1091483623 12:860938-860960 TTGGCGGGGGGTGGTGGTGGGGG + Intronic
1091771326 12:3153061-3153083 GTGGGGTGTGGTGGTGGTGGTGG + Intronic
1091827753 12:3525952-3525974 CTGGAGATGGGTGGTGGTGATGG - Intronic
1091933635 12:4417244-4417266 CTGGAGAGGGATGGTGGTGACGG + Intergenic
1092460162 12:8679330-8679352 CAGGCACGTGGTGGTGGTGGCGG - Intergenic
1092659514 12:10723064-10723086 CGGGAGGGTGGTGGTGGTGGTGG + Exonic
1093646471 12:21590575-21590597 CTGGACAGTGGGTGTGGTGTGGG - Intronic
1094201378 12:27797907-27797929 CTGGCGGGTGACGGTGTTGTAGG - Exonic
1095439715 12:42228234-42228256 CTGGAGGGAGGTGGGGGTGTCGG + Intronic
1096485007 12:51974156-51974178 TTGGCGGGTGGAGGTGGTGGGGG - Intronic
1096491640 12:52015790-52015812 CTGGCGAGTTCAGGTGGGGTGGG + Exonic
1096867761 12:54575462-54575484 GTGGCAAGTGGTGGGGGTGGGGG - Intronic
1097707483 12:62882909-62882931 CTGGGGAGTGGCGGTGGGGGTGG - Intronic
1098950657 12:76637373-76637395 CTAGTGAGTGATGCTGGTGTTGG - Intergenic
1099153616 12:79146499-79146521 CTGTGGTGTGGTGGTGTTGTAGG - Intronic
1099205721 12:79723968-79723990 CTGGAGAGAGGTGGTGGTGGGGG - Intergenic
1100806643 12:98292515-98292537 CTGGGGGGAGGTGGTGGTGGTGG - Intergenic
1102226358 12:111231127-111231149 CTGGAGATGGATGGTGGTGTTGG - Intronic
1103553179 12:121750817-121750839 GTGGTGTGTGGTGTTGGTGTGGG - Intronic
1103658220 12:122491751-122491773 CTGGCAGGTGGAGGTTGTGTTGG + Intronic
1104502885 12:129303139-129303161 CCGGCGAGTGATGATGGTGGAGG - Intronic
1104502891 12:129303174-129303196 CCGGCGAGTGATGATGGTGGAGG - Intronic
1104502897 12:129303209-129303231 CCGGCGAGTGATGATGGTGGAGG - Intronic
1104502903 12:129303244-129303266 CCGGCGAGTGATGATGGTGGAGG - Intronic
1104502909 12:129303279-129303301 CCGGCGAGTGATGATGGTGGAGG - Intronic
1104502915 12:129303314-129303336 CCGGCGAGTGATGATGGTGGAGG - Intronic
1104502921 12:129303349-129303371 CCGGCGAGTGATGATGGTGGAGG - Intronic
1104502927 12:129303384-129303406 CCGGCGAGTGATGATGGTGGAGG - Intronic
1104502933 12:129303419-129303441 CCGGCGAGTGATGATGGTGGAGG - Intronic
1104502939 12:129303454-129303476 CCGGCGAGTGATGATGGTGGAGG - Intronic
1104502945 12:129303489-129303511 CCGGCGAGTGATGATGGTGGAGG - Intronic
1104502951 12:129303524-129303546 CCGGCGAGTGATGATGGTGGAGG - Intronic
1104502957 12:129303559-129303581 CCGGCGAGTGATGATGGTGGAGG - Intronic
1104502963 12:129303594-129303616 CCGGCGAGTGATGATGGTGGAGG - Intronic
1104889703 12:132134423-132134445 CAGGCGAGAGGGGGTGGGGTGGG - Intergenic
1104966543 12:132511040-132511062 GTGGCGAATGGTGAAGGTGTGGG + Intronic
1105402661 13:20109638-20109660 CTGGAGAGGGGAGGTGGTGGGGG - Intergenic
1105511245 13:21053383-21053405 CCAGCCAGTGGTGGTGCTGTGGG - Intronic
1105800376 13:23897827-23897849 CTGGAGATGGGTGGTGGTGATGG + Intronic
1105806836 13:23956634-23956656 CAAGCTATTGGTGGTGGTGTTGG + Intergenic
1105828995 13:24147689-24147711 CTGGAGATGGATGGTGGTGTTGG - Intronic
1105848636 13:24315130-24315152 CTGGAGATGGGTGGTGGTGATGG - Intronic
1106316062 13:28594889-28594911 CTGGAGAGGGATGGTGGTGATGG + Intergenic
1106317203 13:28605157-28605179 CTGTTGTGTGGTGGGGGTGTGGG - Intergenic
1107300554 13:38961544-38961566 CTGGGAGGTGGTGGTGGTGGTGG - Intergenic
1107599854 13:42002393-42002415 CTGGGGAGAGGTTGAGGTGTAGG - Intergenic
1107808371 13:44175621-44175643 ATGGTGGGGGGTGGTGGTGTGGG + Intergenic
1110695746 13:78486309-78486331 CTGGCCAGTGTTGGTGGTGGAGG - Intergenic
1111216726 13:85152609-85152631 GTTGCGTGTGGTGGTGATGTAGG + Intergenic
1112035570 13:95493390-95493412 CTGGAGATGGGTGGTGGTGATGG - Intronic
1112407539 13:99134580-99134602 CTGGCCAGCACTGGTGGTGTGGG - Intergenic
1113387135 13:109859149-109859171 CTGGAGAGGGATGGTGGTGATGG + Intergenic
1113722006 13:112565249-112565271 CTTGCGAGTTATGGTGTTGTAGG - Intronic
1114317664 14:21523194-21523216 CTGTCAGGTGGTGGTGGTGGTGG + Exonic
1116233600 14:42249509-42249531 CCGGCGGGTGGGGGTGGGGTCGG - Intergenic
1116481554 14:45397347-45397369 TTAGCTAGGGGTGGTGGTGTGGG + Intergenic
1116892888 14:50286004-50286026 CTGCCAAGTTGGGGTGGTGTTGG + Intronic
1116900721 14:50360287-50360309 CTGGTGATAGGTGGTGGTGATGG - Intronic
1117180756 14:53189227-53189249 CTGGGATGGGGTGGTGGTGTGGG + Intergenic
1117677447 14:58169151-58169173 CTAGCACGTGGTGCTGGTGTTGG - Intronic
1118673127 14:68152439-68152461 CTAGCAAGTGGTGCTGATGTTGG - Intronic
1119037046 14:71239251-71239273 CTGGAGAGGGATGGTGGTGATGG + Intergenic
1120974528 14:90237085-90237107 CTGGGGGGTGGAGGTGGTGGGGG - Intergenic
1120986973 14:90343539-90343561 GTGGGGAGTGGGGGTGCTGTGGG + Intergenic
1121065045 14:90954715-90954737 GTGGGTAGTGGTGGTGGTGGTGG + Intronic
1121671043 14:95710934-95710956 GTGGCGAGGGGTGGTGCTGCTGG + Intronic
1121777301 14:96599055-96599077 CTGGGGAGGGATGGTGGTGAGGG + Intergenic
1122016482 14:98801123-98801145 CTGGCCATTGGTGGTGGTAGAGG - Intergenic
1122038585 14:98965720-98965742 CTGGGCACTGGTGGGGGTGTTGG + Intergenic
1122172587 14:99889284-99889306 CTGGTGGGTGGTGGTGGGGTCGG - Intronic
1122825436 14:104368355-104368377 CAGGTGAGAGGTGGTGGTGCTGG + Intergenic
1202852355 14_GL000225v1_random:29806-29828 CTGCCGGTGGGTGGTGGTGTGGG - Intergenic
1123423710 15:20151690-20151712 GTGGGGAATGGTGGTGGTCTTGG + Intergenic
1123532932 15:21158211-21158233 GTGGGGAATGGTGGTGGTCTTGG + Intergenic
1123719574 15:23049286-23049308 CTGGCCAGAGGTGCTGGTGGGGG + Intergenic
1124402797 15:29364852-29364874 CTGGCGGCTGGTGGTAGTGGCGG - Intronic
1124941758 15:34224959-34224981 CTGGAAATTGGTGGTGCTGTGGG - Intergenic
1125035670 15:35121393-35121415 CTGGGGAGCTGTGGTGGTGATGG + Intergenic
1125457357 15:39873739-39873761 CTGGCTTGTGGTGATGGTGAAGG - Intronic
1125546207 15:40507390-40507412 CTGGCGAGGGGTGATGTTGCCGG + Intergenic
1125645268 15:41267173-41267195 CTGGGGGATGGTGGTGGTGATGG + Intronic
1126600995 15:50427388-50427410 CTGAAGAGTGGTGGTGGTATTGG + Intronic
1127944038 15:63731988-63732010 CTGAAGGGTGGTGGTGGTGGTGG + Intronic
1128977931 15:72166997-72167019 CTGGCTGGTGTTGGTGGTGATGG + Exonic
1128989861 15:72250806-72250828 CTGGGCAGTGGGGGTGGTGAGGG - Intronic
1129162708 15:73755594-73755616 CTGGAGATGGGTGGTGGTGATGG - Intergenic
1129163873 15:73764139-73764161 CTGGGGAGTGAGGGTGGTGGCGG + Intergenic
1130051121 15:80484793-80484815 CTGAGGAGTGGTGGTGGGGATGG + Intronic
1131021851 15:89105826-89105848 CTGGCTTGAGGTGGTGGTGGTGG + Intronic
1131118689 15:89809689-89809711 CTGACGTGTGCTGGTGGGGTTGG - Intronic
1131558373 15:93418515-93418537 CTGGGGAGGGGTGGTGATGTTGG + Intergenic
1132801384 16:1756065-1756087 CTGGCGGGTGGTAATGGTGGTGG + Intronic
1133366757 16:5216337-5216359 CTGGGGAGTGGAGCTGGTGGTGG + Intergenic
1133449771 16:5894062-5894084 CTGGCAAATGGTCATGGTGTGGG + Intergenic
1133923941 16:10179702-10179724 CTGTGGGGTGGTGGTGGTGGCGG - Intronic
1134221407 16:12357621-12357643 CTGGAGAGGGGTGGTGGCGATGG - Intronic
1135050685 16:19190495-19190517 CTGGAGAGGGATGGTGGTGATGG - Intronic
1135531976 16:23262645-23262667 ATGGATTGTGGTGGTGGTGTGGG + Intergenic
1136315771 16:29454053-29454075 CTTCCGAGTCCTGGTGGTGTCGG - Exonic
1136430348 16:30193395-30193417 CTTCCGAGTCCTGGTGGTGTCGG - Exonic
1136505083 16:30698178-30698200 CGAGCGAGTGGTGGTGGTAGTGG + Intergenic
1136512762 16:30748994-30749016 TTCGCGGGTGGTGGTGGTGGTGG + Intronic
1136539876 16:30923447-30923469 CTGGAAAGTGGAGGTGGTGGAGG + Intronic
1136560019 16:31033676-31033698 CTGGCGGCTCGTGGGGGTGTTGG + Exonic
1136641560 16:31569453-31569475 CTGGAGGGTGGTGGTGATGATGG + Intergenic
1137271609 16:46906046-46906068 CTGGCCAGTGGTGCTAATGTGGG + Intronic
1138360018 16:56420289-56420311 CAGGGGAGTGGTGCTGGTGTAGG - Intronic
1138540530 16:57684822-57684844 CTGGAGAGTGGAGGGTGTGTTGG + Intronic
1138703677 16:58892518-58892540 GTGGTGAGTGGTAGTGGTGGTGG - Intergenic
1139185234 16:64798547-64798569 CTGTCGCGGGGTGGGGGTGTAGG - Intergenic
1139358115 16:66379597-66379619 GTGACAAGTGGTGGTGGTGATGG + Intronic
1139366838 16:66438810-66438832 ATAGCGAGTGGTGGTGGTTTGGG - Intronic
1139512544 16:67435823-67435845 CTGACCGGTGCTGGTGGTGTGGG - Exonic
1140015162 16:71175402-71175424 GTGGGTAGTGGTGGTAGTGTTGG - Intronic
1140313718 16:73873021-73873043 GTGGTGAGTGGCGGTGGTGGTGG + Intergenic
1140313732 16:73873063-73873085 GTGGCGGATGGTGGTGGTGGTGG + Intergenic
1140742310 16:77952455-77952477 CAGGCGAGGGGTGGTGGTGGGGG - Intronic
1141396360 16:83708582-83708604 TTGGGGAGTGGAGGCGGTGTGGG - Intronic
1141496665 16:84414963-84414985 CGGGCAAGCGGCGGTGGTGTGGG + Intronic
1141950362 16:87335624-87335646 CTGGTGGGTGGTGGGGGTGAGGG - Intronic
1142332064 16:89461339-89461361 CTGGAGAGGGATGGTGGTGATGG + Intronic
1142703889 17:1682089-1682111 ATGGTGGGTGGTGGTGGTGGTGG - Intronic
1142977829 17:3656108-3656130 CTGGCGAGGGGTGGAGGGGCAGG - Intronic
1142977913 17:3656310-3656332 CTGGCGAGGGGTGGTGGGGCAGG - Intronic
1143109421 17:4545006-4545028 CTGGTGAGTGGGGGAGGTGGAGG - Exonic
1143585553 17:7848662-7848684 CTGGGGGGTGGGGGTGGTGGTGG - Exonic
1144051831 17:11503389-11503411 CTGGAGAGTGGAGGTGGGGGTGG + Intronic
1144566318 17:16362467-16362489 CTGGAGAGGGATGGTGGTGATGG + Intergenic
1144703316 17:17352244-17352266 ATAGCGAGGGGTGGTGGTGGCGG + Intergenic
1144819964 17:18065631-18065653 CTGGCGGGGGGTGGGGGTCTAGG - Exonic
1145835183 17:27949438-27949460 CTGGCAGGTCGTGGTGGTGAGGG - Intergenic
1145851052 17:28097019-28097041 CTGGCTAGAGGTGGTGGTGATGG - Intronic
1146566430 17:33916965-33916987 CTGGTGAGTGGTGGTGTGGGTGG + Intronic
1147575790 17:41598425-41598447 GGGGCGAGTGGTGATGGTGGGGG + Intergenic
1147987293 17:44313989-44314011 CTTGCAAGTGGTGGTGGTGGTGG - Intronic
1149459816 17:56819362-56819384 ATGGAGAGTGGTGGTGGTGGGGG - Intronic
1149469667 17:56905831-56905853 CTGGAGAGTGGGGGTGGTGAAGG + Intronic
1149562044 17:57615005-57615027 CAGGAGTGTGGTGGTGGTGTAGG + Intronic
1149665662 17:58363361-58363383 CTGGCCAGTGGTGTTGATCTGGG - Exonic
1149737738 17:59012242-59012264 GTGGTGGGTGGTGGTGGTGGTGG - Intronic
1149795977 17:59520403-59520425 CTGGAGATGGGTGGTGGTGACGG - Intergenic
1149909173 17:60552088-60552110 CTGGAGGGAGGTGGGGGTGTCGG + Intergenic
1149981346 17:61313885-61313907 CGGGCGAGTGGGGCTGGTGGAGG - Intronic
1152069484 17:78127871-78127893 CTGGAGGGAGGGGGTGGTGTGGG - Intronic
1152245407 17:79182643-79182665 CTGGCGAGTTGGGGTTGGGTGGG - Intronic
1152504719 17:80741290-80741312 GTGGAGGGTGGTGCTGGTGTGGG + Intronic
1152634702 17:81426040-81426062 GTGGCTCGTGGTGGTGGTGGTGG + Intronic
1152634808 17:81426489-81426511 ATGGCTCGTGGTGGTGGTGGTGG + Intronic
1153476565 18:5505001-5505023 CTGCTGAGTGAAGGTGGTGTTGG - Intronic
1153969837 18:10216048-10216070 CTGGGCAGTGGTGGTGGTGGAGG + Intergenic
1154291006 18:13106590-13106612 GTGGTGAGTGGTAGTGGTGGTGG - Intronic
1154451047 18:14474991-14475013 CTGGCGCGGGGTGGGGGTGGAGG - Intergenic
1155025728 18:21938818-21938840 CTGGAGATGGATGGTGGTGTTGG + Intergenic
1155280095 18:24230318-24230340 CTGGAGAGAGATGGTGGTGATGG + Intronic
1156378235 18:36533488-36533510 ATGGTGAGTTGTGGTGCTGTAGG + Intronic
1157580853 18:48773465-48773487 CTGGCTGGTGGGGGTGGTGGTGG - Intronic
1157589650 18:48828799-48828821 CTGGCGAGTGGGGGCAGTGAGGG + Intronic
1157690326 18:49676661-49676683 CTGGAGATTGGTGTTGGTGATGG + Intergenic
1158060458 18:53334505-53334527 CTGGAGATGGGTGGTGGTGATGG - Intronic
1158876262 18:61737245-61737267 CTGGCAATGGGTGGTGGTGATGG + Intergenic
1161077820 19:2294804-2294826 GTGGCGGGTGGAGGTGGGGTTGG + Intronic
1161344380 19:3760764-3760786 CTAGCTAGGGGTGGTGGTGTAGG + Intronic
1161607895 19:5224992-5225014 GTGGGGCGTGGTGGTGGTGGTGG - Intronic
1161910027 19:7186573-7186595 CTGGAGATGGGTGGTGGTGATGG - Intronic
1163028925 19:14530861-14530883 CTGGAGATGGGTGGTGGTGATGG - Intronic
1163283912 19:16334348-16334370 CTGGAGATGGGTGGTGGTGAAGG - Intergenic
1163653920 19:18534525-18534547 CTCGCCAGTGGAGGTGGTGAGGG - Intronic
1163753370 19:19091978-19092000 GTGGCGGGTGCTGGTGGTGCTGG + Intronic
1164917300 19:32062244-32062266 CTGGGGATTGTTGGTGGGGTTGG - Intergenic
1165798949 19:38536126-38536148 ATGGCGGGTGGGGGTGGGGTGGG - Intronic
1165824635 19:38698734-38698756 ATGGTGAGAGGTGGTGGTGGGGG + Intronic
1165861222 19:38910607-38910629 CTGGCTGGTGGTGGTGGTGGTGG + Exonic
1165864094 19:38925481-38925503 CTGGAGTGTGGTGGGGGTCTGGG + Intronic
1166461277 19:42990846-42990868 CTGGCCACTGGGGCTGGTGTGGG + Intronic
1166501235 19:43343159-43343181 CTGGCCACTGGGGCTGGTGTGGG + Intergenic
1167013597 19:46825061-46825083 AAGGCAGGTGGTGGTGGTGTTGG - Intergenic
1167439880 19:49501834-49501856 CTGGTGGGTGCTGGGGGTGTGGG - Intergenic
1167483586 19:49747277-49747299 GTGCAGTGTGGTGGTGGTGTCGG + Intronic
1167613351 19:50517779-50517801 GTGGCCAGTGGGGGTGGTGTGGG - Exonic
1167987406 19:53330352-53330374 CTGGCCATTTGTGTTGGTGTTGG + Intergenic
925444982 2:3919872-3919894 CAGGTGAGAGGTGGTGCTGTAGG + Intergenic
926048764 2:9729789-9729811 CTGGCCAGGGGTGCTGCTGTGGG + Intergenic
926975599 2:18513953-18513975 ATGACCAGTGGTGGTGGTGGTGG - Intergenic
927441550 2:23122002-23122024 TTGGTGAGTGGTGGCGGTGTTGG + Intergenic
928110684 2:28506440-28506462 CTGGAGTGTGGGGTTGGTGTAGG + Intronic
929454256 2:42055054-42055076 CTGGCGGGTGGGGGTGGGGTAGG - Intronic
930151978 2:48068619-48068641 ATGGCGAGTGGTGGGTGGGTGGG + Intergenic
930703752 2:54484755-54484777 CCGGCGTGGGGTGGTTGTGTCGG + Intronic
931906115 2:66845778-66845800 CTGGCGAGTGGTTGCAGTGCAGG - Intergenic
932174279 2:69585393-69585415 TTGGGGAGTTGGGGTGGTGTGGG - Intronic
933749828 2:85596075-85596097 CTGGAGAGTGGTGGGCGTGGGGG + Intronic
934459485 2:94205059-94205081 GTGGGGAGTGGTGGTTGTGTTGG - Intergenic
934525346 2:95048395-95048417 CTGGCGGGTACAGGTGGTGTGGG - Intronic
934893363 2:98089502-98089524 CGGGCTAGTGGGGGTGGGGTGGG + Intronic
935398632 2:102637462-102637484 CTGTCCAGTGGGTGTGGTGTGGG + Intronic
935607343 2:104984214-104984236 CTGGGATCTGGTGGTGGTGTTGG - Intergenic
935688647 2:105710529-105710551 CTGGAGATTGATGGTGGTGATGG - Intergenic
935745024 2:106182813-106182835 CTGGTGGGTGGGGGTGGGGTGGG + Intronic
937613520 2:123892911-123892933 CTGTGGACTGGTGGTGGTGGTGG - Intergenic
937908858 2:127065662-127065684 CTGGGGAGTTGTGGGGGTGGTGG - Intronic
937967487 2:127525131-127525153 ATGGGGGGTGGGGGTGGTGTTGG + Intronic
938091332 2:128436711-128436733 CTGGCAAGTGGTGCTGGTTCAGG + Intergenic
940622867 2:156134759-156134781 CTCTCCAGTGGTGGTGGTGGTGG - Intergenic
942161612 2:173194863-173194885 CTGGGGAGGGCTGGTGGTTTTGG - Intronic
942353146 2:175076345-175076367 CTGGTGGTTGGTGGTGGTGGTGG - Intronic
942527898 2:176875137-176875159 GTGGTGGGTGGTGGTGTTGTGGG + Intergenic
944976422 2:205057992-205058014 CTGGAGAGAGGTGGTAGTGATGG - Intronic
945032946 2:205682248-205682270 CGGGCGAGGGGTGGTGGGATGGG + Intronic
945256962 2:207810988-207811010 GCGGGGAGTGGTGGTGGTGAGGG + Intergenic
946005340 2:216520115-216520137 CTGGTGAGTGATGGTGGGTTGGG + Intronic
946245909 2:218387252-218387274 TAGGGGAGTGGTGGTGGTGAGGG + Intronic
947769705 2:232661237-232661259 CTGGCGATGGATGGTGGTGATGG - Intronic
947800370 2:232925869-232925891 CTGGGTGGTGGTGGTGGTGGTGG - Intronic
947895532 2:233668202-233668224 CTGTCGAGAGGTGGGGGTATGGG - Intronic
948183106 2:235998647-235998669 ATGGTGAGAGGTGGTGGTGGTGG + Intronic
948183178 2:235999093-235999115 ATGGTGAGAGGTGGTGGTGGTGG + Intronic
948183221 2:235999393-235999415 ATGGTGAGAGGTGGTGGTGGTGG + Intronic
948183252 2:235999592-235999614 ATGGTGAGAGGTGGTGGTGGTGG + Intronic
948768011 2:240233401-240233423 CTGGAGAGGGGAGGTGCTGTGGG - Intergenic
949022454 2:241749189-241749211 GTGGGAGGTGGTGGTGGTGTTGG - Intronic
949055826 2:241927890-241927912 CTTGTGAGTGGAGGTGGAGTGGG - Intergenic
949055976 2:241928453-241928475 CTTGTGAGTGGAGGTGGAGTGGG - Intergenic
949056016 2:241928601-241928623 CTTGTGAGTGGAGGTGGAGTGGG - Intergenic
1168746344 20:245708-245730 CTGGGGTGTGGTGGAGGGGTAGG - Intergenic
1168959780 20:1860891-1860913 CAGGGGAGTGGTGGTGGTGGTGG + Intergenic
1169146531 20:3256115-3256137 TTGGAGTCTGGTGGTGGTGTGGG + Exonic
1169587072 20:7096950-7096972 ATGGCCTGTGGTGGTGGTGGTGG + Intergenic
1169757826 20:9062340-9062362 CTGTGGTGTGGTGGTGGTGGTGG + Intergenic
1170966873 20:21081496-21081518 CTGGAGAGGGATGGTGGTGATGG + Intergenic
1171035689 20:21710682-21710704 CTGGGGAGTGGGGGTGGGGTGGG + Intronic
1171256296 20:23691096-23691118 CTTGGGAGTGGTGGAGGTGAGGG + Intergenic
1172019170 20:31900777-31900799 CTAGCAGGTGGGGGTGGTGTAGG + Intronic
1172381039 20:34491995-34492017 CTGGGGGGTGGTGGTGGGATGGG + Intronic
1172848075 20:37941861-37941883 ATGGAGAGGGGTGGTGGTGGTGG - Intronic
1172850062 20:37955404-37955426 CTGGAAGGTGGTGGTGGGGTGGG - Intergenic
1173693893 20:44990599-44990621 CTGGGAAGTGGTGGTGGTGGTGG + Intronic
1173759314 20:45545932-45545954 CTGGGGAGTGGTGGGGGTGTAGG - Intronic
1173927453 20:46791400-46791422 CTGGAGATGGGTGGTGGTGATGG + Intergenic
1174624943 20:51906251-51906273 CTGGAGAGTGTTGTTAGTGTCGG + Intergenic
1175303361 20:57958771-57958793 CTGGTTAGTGCTGGTGGTGTCGG + Intergenic
1175525951 20:59633495-59633517 CTGTTGAGTGGTGGGGGTGAGGG + Intronic
1176289801 21:5037931-5037953 ATGGGGAGTGGTGGGGGTGGGGG - Intronic
1176304563 21:5116416-5116438 CTGGGGAGTGATGGTAGCGTTGG - Exonic
1176445187 21:6815582-6815604 CTGGCGCGGGGTGGGGGTGGAGG + Intergenic
1176823354 21:13680615-13680637 CTGGCGCGGGGTGGGGGTGGAGG + Intergenic
1177368927 21:20176258-20176280 CTGGAGTGTAGTGGTGGTCTCGG - Intergenic
1178330675 21:31688064-31688086 CTGGAATGTGGTGGTGATGTTGG - Intronic
1179125624 21:38588317-38588339 TTGGAGGGTGGTGGTGGTGGTGG - Intronic
1179433908 21:41346554-41346576 CTGCTCAGTGGTCGTGGTGTGGG + Intronic
1179658803 21:42861945-42861967 CTGGTGGGTGGTGGGGGTGTTGG - Intronic
1179852493 21:44145614-44145636 CTGGGGAGTGATGGTAGCGTTGG + Exonic
1179867429 21:44225656-44225678 ATGGGGAGTGGTGGGGGTGGGGG + Intronic
1179950052 21:44704246-44704268 CTGGAGAGTGGTGGGGGGGTGGG - Intronic
1180819225 22:18814127-18814149 CTGGCGAGTGGAGGTGTACTGGG - Intergenic
1181162236 22:20965722-20965744 GTGGCGAGAGGTGGAGGAGTGGG + Intronic
1181205449 22:21248571-21248593 CTGGCGAGTGGAGGTGTACTGGG - Intergenic
1181318762 22:21988711-21988733 CGGGAGAGTGGTGGTCATGTGGG - Intergenic
1181528164 22:23501897-23501919 ATGGCGGGTGGTGGAGGTGGCGG - Intergenic
1181915997 22:26280617-26280639 GTGGGGAGAGGTGGAGGTGTAGG - Intronic
1182044611 22:27264439-27264461 GTGGTGAGAGATGGTGGTGTTGG + Intergenic
1182782660 22:32880529-32880551 CTGGTGGGTGGTGGTGGAGAGGG + Intronic
1183585303 22:38749943-38749965 CTGGCAGGTGGGGGTGGGGTAGG - Intronic
1184147779 22:42621659-42621681 CTGTCCCGTGGTGGTGGTGCAGG + Intronic
1184359719 22:44007753-44007775 CTGGAGATGGGTGGTGGTGATGG - Intronic
1184382858 22:44156932-44156954 CTGGAGATGGGTGGTGGTGAGGG + Intronic
1184486124 22:44780723-44780745 TTGGCCAGTGGTGGGGGTGAGGG - Intronic
1184521377 22:44996176-44996198 CTGGCGAGTGGTCCTGCTGAGGG - Intronic
1184537633 22:45098303-45098325 CTGGAGATGGGTGGTGGTGATGG + Intergenic
1184663852 22:45977395-45977417 GTGACGAGTGGTGGGGGTGCGGG + Intergenic
1184697770 22:46149766-46149788 CTGGAGAGGGGTGGGGTTGTGGG + Intergenic
1203221475 22_KI270731v1_random:46841-46863 CTGGCGAGTGGAGGTGTACTGGG + Intergenic
1203269351 22_KI270734v1_random:39980-40002 CTGGCGAGTGGAGGTGTACTGGG - Intergenic
949359994 3:3221507-3221529 CAGGCCAGGGGTGGTGGTGGTGG + Intergenic
950460425 3:13118716-13118738 CTGGAGATGGATGGTGGTGTTGG + Intergenic
953057987 3:39403536-39403558 CTGGCCAGATGTGGTGGTGCGGG + Intergenic
953690154 3:45110906-45110928 CAGCCGAGGGGTGGGGGTGTAGG + Intronic
953769742 3:45771067-45771089 CCAGCAACTGGTGGTGGTGTAGG + Intronic
953993255 3:47499939-47499961 CTTCCGAGTCCTGGTGGTGTCGG + Intronic
954274184 3:49531833-49531855 CCTGCGAGTCGTGGTGGTGGTGG - Exonic
954386482 3:50246555-50246577 CTGGGGAGTTGTGGCAGTGTGGG + Intronic
954472236 3:50707839-50707861 GATGCCAGTGGTGGTGGTGTTGG + Intronic
955001098 3:54928697-54928719 CTGGGGAGTGGGTGGGGTGTGGG - Intronic
955159951 3:56455108-56455130 CTGGAGATTGATGGTGGTGATGG + Intronic
956987892 3:74724423-74724445 ATGGTAAGTGGTGGTGGTTTGGG - Intergenic
957236748 3:77602710-77602732 CTGGTGTGTGGTGGTGGTGGAGG - Intronic
958734020 3:97989043-97989065 GTGGTGAGTGGTGGTGATGGTGG + Intronic
958734115 3:97989446-97989468 GTGGTGGGTGGTGGTGGTGGTGG + Intronic
959170314 3:102836396-102836418 CTGTTGCGTGGTGGTGGTTTGGG - Intergenic
959498502 3:107078532-107078554 CTGGCCAGATGTGGTGGTGGTGG - Intergenic
959644118 3:108678342-108678364 CTGGGGAGTGGAGATGGTTTTGG - Intronic
960101501 3:113747132-113747154 CTGGCGAGTGGTGGGGATAGAGG + Intronic
961495270 3:127286990-127287012 TGGGTGAGTGGTGGTGGTGGTGG + Intergenic
961781150 3:129320629-129320651 CTGGGCAGTGGTGGTGGGGAAGG - Intergenic
962111871 3:132459487-132459509 CTAGCGATGGGTGGTGGTGATGG + Intronic
962454203 3:135550023-135550045 CTGGGGGGTGGCGGTGGGGTAGG - Intergenic
965075724 3:163973127-163973149 ATAGGGAGTGGTGGTGGCGTTGG + Intergenic
965630420 3:170726962-170726984 CTGGCTTGTGGTGGTGGTGGAGG + Intronic
966351261 3:179034717-179034739 ATGACTAGTGGTGGTGGTGATGG - Intronic
966943962 3:184764596-184764618 CTTGAGGGTGGTGGTGGTGGTGG - Intergenic
966948162 3:184792274-184792296 CTGGGGAGTGGTGGGGGTTGAGG - Intergenic
967145470 3:186602532-186602554 CAGGAGAGTGGGGGTGGGGTGGG - Intergenic
967158986 3:186718307-186718329 GTGGTGGGTGGTGGTGGTGGTGG - Intronic
967158999 3:186718340-186718362 GTGGTGGGTGGTGGTGGTGGTGG - Intronic
968067642 3:195767669-195767691 GTGGCCAGTGATGGTGGTGATGG - Intronic
968230176 3:197001213-197001235 GCGGCGAGGGGTGGTGGTGTGGG + Intronic
968662388 4:1804095-1804117 CGGGCGCCTGGTGGCGGTGTGGG + Intronic
968761674 4:2445452-2445474 GTGGGGAGTGGGGGTGGGGTGGG - Intronic
968807942 4:2787359-2787381 CTGGCAGGGGGTGGTGGTGGGGG + Intergenic
968808027 4:2787751-2787773 CTGGGGAGTGCTGGTGGCCTGGG + Intergenic
969479617 4:7441017-7441039 TTGGGGAGAGGTGGTGCTGTCGG + Intronic
971229569 4:24790100-24790122 CTGGTGAGTGATGGTGGTTTGGG + Intronic
972396899 4:38664937-38664959 CTGGGTTGTGGTGGTGGTGGGGG - Intronic
972511553 4:39771839-39771861 TTGGCTAGGGGTGGAGGTGTAGG + Intronic
973257071 4:48124280-48124302 TTGGAAGGTGGTGGTGGTGTGGG - Intronic
974474773 4:62364354-62364376 TGGAGGAGTGGTGGTGGTGTTGG + Intergenic
974480968 4:62442437-62442459 TGGGGGAGTGGTGGTGGTGGTGG + Intergenic
977494105 4:97753160-97753182 TTGGGAAGTGGTGGTGGTGATGG - Intronic
978673701 4:111283241-111283263 CTGCCGCCTGGTGGTGGGGTAGG + Intergenic
979130866 4:117043229-117043251 CTTGCTAGGGGTGGTGATGTTGG + Intergenic
979195658 4:117917177-117917199 CTGGGTAGCGGTGGTGGTGGCGG - Intergenic
979409537 4:120359538-120359560 CTGGTCAGTGGTGGAGTTGTGGG + Intergenic
979760420 4:124395927-124395949 CAGGCAAGTGCTGGTGGTGTTGG + Intergenic
981107664 4:140899526-140899548 CTGGAGATTGGTGGTGGTGGTGG + Intronic
981448758 4:144871461-144871483 CTGGAGATGGGTGGTGGTGATGG + Intergenic
982123612 4:152165248-152165270 CTGGGGGCTGGTGGTGGTGGTGG - Intergenic
983416087 4:167456769-167456791 CAAGGGAGTGGTGGTGGTGGTGG + Intergenic
983458534 4:167996932-167996954 CTGCCCAGTTGTGGTGGTCTGGG - Intergenic
984625350 4:182001080-182001102 TTGGTGGGTGGTGGTGGTGAAGG - Intergenic
985550576 5:531492-531514 CTGGAGGCTGGTGCTGGTGTGGG + Intergenic
985770523 5:1807346-1807368 CTGGAGATGGGTGGTGGTGATGG + Intronic
986581661 5:9272163-9272185 CTGGAGCTTGGTGGGGGTGTAGG + Intronic
986664326 5:10087142-10087164 CTGGCGAGAGGTGCGGGTGAGGG - Intergenic
986681604 5:10238159-10238181 CTGGAGATGGGTGGTGGTGATGG + Intronic
988098335 5:26646043-26646065 CTGGTGGGTGGTGATGGTGATGG + Intergenic
988896146 5:35676900-35676922 CCGGACAGGGGTGGTGGTGTGGG - Intronic
991118113 5:62977870-62977892 CAGGCATGTGGTGCTGGTGTGGG + Intergenic
991585921 5:68201795-68201817 TTGGCGAATGGAGGTGGTGATGG + Intergenic
991972396 5:72153596-72153618 GTGGCGTGTGGTGGTGGTGGTGG + Intronic
992445118 5:76826650-76826672 TTAGCCAGAGGTGGTGGTGTGGG - Intronic
992684660 5:79187753-79187775 CTGGCTGGGTGTGGTGGTGTAGG + Intronic
994092910 5:95824420-95824442 ATGGGGAGTGGTGGTGGTGGTGG - Intergenic
994153409 5:96475157-96475179 CTGGCCAGTGGAGGTTCTGTCGG + Intergenic
995188743 5:109298495-109298517 CAGCAGAGTGGTGGTGGTGGTGG - Intergenic
996729253 5:126701475-126701497 CAGGCTGGTGGTGGTGGTGGTGG + Intergenic
996843818 5:127877809-127877831 CAGGGGAGTGGTGGTGTTCTAGG - Intergenic
996871154 5:128194614-128194636 TTGGAGAGTGGTGGTGGTGGTGG - Intergenic
997897395 5:137731920-137731942 CTGGAGATGGGTGGTGGTGATGG - Intronic
998364073 5:141617765-141617787 CTGGAGAGAGGCGTTGGTGTGGG + Intronic
999044028 5:148448329-148448351 CTGGAGAGTGGTGGGGGGGCGGG - Intergenic
1000339248 5:160264651-160264673 CTGGAGAGGGATGGTGGTGATGG - Intronic
1000991388 5:167915476-167915498 CTGGTGGTTGGTGGGGGTGTAGG - Intronic
1001290720 5:170457319-170457341 CTGACATGTGGTGGTGGTGGTGG - Intronic
1001525776 5:172427705-172427727 CTGGCGATGGATGGTGGTGATGG + Intronic
1001923058 5:175615885-175615907 CTGGCGATAGATGGTGGTGATGG + Intergenic
1001964102 5:175898293-175898315 CTGGAGAGGGGTGGTGGTGATGG - Intergenic
1002933832 6:1654651-1654673 CTGGAGATGGGTGGTGGTGATGG + Intronic
1003447189 6:6195308-6195330 CTGGCCACAGGTGATGGTGTGGG + Intronic
1004567115 6:16808306-16808328 TTGGTGAGTGGTGGGGGTTTAGG - Intergenic
1006350957 6:33520990-33521012 GGGGGGGGTGGTGGTGGTGTCGG - Intergenic
1006633074 6:35443194-35443216 CTGGGGAGTGGTGTTAGGGTGGG + Intergenic
1007411480 6:41664585-41664607 TTGGCGTGTGGTGGTGGTGGGGG - Intergenic
1007725140 6:43911519-43911541 CTGGGGAGTGTTGGGGGTGGTGG - Intergenic
1007830901 6:44637419-44637441 CTCCCAAGTGGTGGTGGTGGGGG + Intergenic
1009298148 6:61980761-61980783 CTGCAGAGTTGTGGTGGTTTGGG - Intronic
1009505115 6:64468103-64468125 TGGGCCACTGGTGGTGGTGTGGG - Intronic
1010318451 6:74477964-74477986 CCAGCGAGTGGTGGTGGTGGTGG + Intergenic
1010953274 6:82061858-82061880 GTGGGGAGAGGTGGTGGTGGTGG - Intergenic
1011109892 6:83826129-83826151 CTGGCTAGTGGTGCTGTTTTTGG - Intergenic
1011277240 6:85643095-85643117 GAGGCTAGTGGTGGTGGTGGTGG - Exonic
1012117549 6:95322406-95322428 CTGTCGTGGGGTGGGGGTGTGGG - Intergenic
1012156539 6:95826191-95826213 CTGTCGTGGGGTGGGGGTGTGGG - Intergenic
1014440512 6:121468543-121468565 GTGGAAAGTGGTGGTGGTGGTGG + Intergenic
1015907100 6:138128721-138128743 CTGAAGAGAGGTGGTGGGGTGGG - Intergenic
1016839470 6:148511874-148511896 CTGGTTGGTGGTGGTGGTGTGGG - Intronic
1018838117 6:167500331-167500353 GTGCCCAGTGGTGTTGGTGTTGG + Intergenic
1019524701 7:1475723-1475745 CTGGAGAGTCGTGGTGTTGTGGG - Intronic
1019906738 7:4070586-4070608 CTGATGAGTAGTGGTGGGGTTGG - Intronic
1020445019 7:8259878-8259900 ATTGCGAATGGTGGTGGGGTTGG + Intronic
1020528135 7:9290870-9290892 ATGGAAAGTGGTGGTGGTGGTGG - Intergenic
1020648283 7:10842924-10842946 CTTAGGAGTGGTGGTGATGTTGG - Intergenic
1021611908 7:22465836-22465858 CTGTCTAGTGGTGGTGGGCTGGG + Intronic
1022209345 7:28193603-28193625 CTTTCCAATGGTGGTGGTGTTGG - Intergenic
1022470324 7:30678037-30678059 GTGGCCAGGGCTGGTGGTGTTGG + Intronic
1022747534 7:33188110-33188132 GTGGCGGGTGGGGGTGGGGTAGG + Intronic
1023567397 7:41537199-41537221 TTAGGGAGTGGTAGTGGTGTGGG - Intergenic
1023607826 7:41945920-41945942 CAGGTGAGTGATGGTGCTGTAGG - Intergenic
1024068784 7:45768627-45768649 CTGGCTGGTGGAGGTGTTGTGGG + Intergenic
1024466679 7:49718694-49718716 CAGGCGAACGGTGGTGGTGGAGG + Intergenic
1026108165 7:67437361-67437383 CTGGAGACTGGTTGTGTTGTAGG - Intergenic
1027472139 7:78586655-78586677 CTGGAGATGGGTGGTGGTGATGG - Intronic
1027944725 7:84730519-84730541 CTGTCGTGTGGTGGTGGGCTGGG - Intergenic
1028082401 7:86594754-86594776 CAGGCTAGGGGTGGTGGTGGGGG - Intergenic
1028452758 7:91004448-91004470 CTGGGGAGTGGTATTGGTGAGGG + Intronic
1028513462 7:91650498-91650520 GTGGGGAGTGGTGATGGTGTGGG - Intergenic
1029148018 7:98460323-98460345 CTGGAGATGGGTGGTGGTGATGG - Intergenic
1029541167 7:101182904-101182926 CAGTAGAGTGGTGGTGATGTGGG + Intergenic
1030250347 7:107436513-107436535 CTGGAGACAGGTGGTGGTGATGG + Intronic
1030311549 7:108073947-108073969 GGGGCGGGTGGTGGTGGTGGTGG + Intronic
1030945315 7:115711995-115712017 CTGTCGTGTGGTGGGGGTCTAGG + Intergenic
1031854229 7:126902875-126902897 TTGGGTACTGGTGGTGGTGTGGG - Intronic
1033199940 7:139359956-139359978 CTGGCGGGTGGCGGTGTTGAAGG + Exonic
1034055759 7:148033293-148033315 CTGGAGATTGGGGGTGGAGTAGG - Intronic
1035142885 7:156781910-156781932 CTGGAGATGGGTGGTGGTGATGG - Intronic
1036300847 8:7568251-7568273 CTGGGGCTTGGTGGTGGGGTAGG - Intergenic
1036726293 8:11223946-11223968 CGGGCGTGGGGTGGTGGTGGGGG - Intergenic
1037133409 8:15433592-15433614 CTGGCATGTGGTGGTGGCGGTGG - Intronic
1037424804 8:18743980-18744002 CTGGGTGGTGGTGGTGGTGGTGG - Intronic
1037431172 8:18815005-18815027 CTAAGGACTGGTGGTGGTGTGGG - Intronic
1038574230 8:28690458-28690480 CTGGGTGGTGGTGGTGGTGGTGG + Intronic
1039896423 8:41719641-41719663 CTGGTGAGTGGGGGTGCTGCTGG - Exonic
1040040549 8:42912495-42912517 CTGGAGATGGGTGGTGGTGATGG + Intronic
1041154470 8:54971011-54971033 AGGGTGAGTGGTGGTGGGGTTGG + Intergenic
1041852365 8:62405624-62405646 CTGCTGGGTGGTAGTGGTGTGGG + Intronic
1043366729 8:79542162-79542184 ATGGATGGTGGTGGTGGTGTTGG - Intergenic
1043468107 8:80534324-80534346 CTGTGGAGTGGAGGTGGTGAGGG + Intergenic
1044802256 8:95969372-95969394 ATAGGGAGTGGTGGTGGTGGAGG - Intergenic
1045499379 8:102733242-102733264 CTTGTCAGTGGTGGTGGTGGTGG + Intergenic
1045816271 8:106280641-106280663 CTGGAGATGGGTGGTGGTGATGG + Intronic
1045883771 8:107071603-107071625 GTGGAGAGTGGTGCTGTTGTTGG + Intergenic
1046499760 8:115060411-115060433 CTGTCGAGGGGTGGGGGTCTAGG + Intergenic
1049021337 8:139959572-139959594 CTGGGGAGGGGTGTTGGTGGTGG - Intronic
1049075117 8:140389464-140389486 CAGGCGAGTGGTGCTGATGCTGG + Intronic
1049555510 8:143279432-143279454 AGGGAGAGGGGTGGTGGTGTGGG - Intergenic
1049746355 8:144264897-144264919 CTGGTGAGGGCTGGTGGGGTGGG - Exonic
1053180798 9:35967957-35967979 CTGGGAAGTGGGGGTGGTGGAGG - Intergenic
1053299229 9:36936779-36936801 ATGGCCAGAGGTGGTGGTGGTGG - Intronic
1053307507 9:36994925-36994947 CTGGGGTGTGGTCGTGGTGGGGG - Intronic
1055146908 9:72946749-72946771 CTGGCTTGGGATGGTGGTGTGGG - Intronic
1055181161 9:73388663-73388685 CTGGGGACTGATGGTGGTGGTGG - Intergenic
1055559529 9:77509024-77509046 CTGGAGAGGGATGGTGGTGATGG - Intronic
1056598019 9:88023638-88023660 CTGGCTGTTGGTGGTGGTGGGGG + Intergenic
1056931797 9:90883771-90883793 CTGGGGAGTGGGTGTGATGTGGG - Intronic
1057038928 9:91833513-91833535 CTGGCGTGTGGCGGTGCTGGTGG - Intronic
1057885058 9:98823649-98823671 TTGGCCAGTGGAGGTGATGTAGG + Intronic
1057952196 9:99378046-99378068 CTGACCAGTGGGGGTAGTGTGGG + Intergenic
1059299532 9:113300918-113300940 CAGGCGTGTGATGGTGGTGCAGG + Intronic
1059563689 9:115360803-115360825 ATGGCCAGAGGTGGTGGAGTTGG + Intronic
1059718038 9:116931792-116931814 CATGGGAGTGATGGTGGTGTGGG + Intronic
1059798514 9:117726242-117726264 CAGGCTAGTGGTGGTGGTGGTGG + Intergenic
1059953831 9:119495555-119495577 CTGGTGAGTGTGTGTGGTGTGGG + Exonic
1060211566 9:121713570-121713592 TTGGCCAGTAGTGGTGGTGCAGG + Intronic
1060716569 9:125935810-125935832 CTGGGGAATGGGGGTGGTGGTGG - Intronic
1061565847 9:131439383-131439405 AAGGAGAGTGGTCGTGGTGTGGG + Intronic
1061839400 9:133348763-133348785 CTGTCGAGGGGTGGTGCTGGGGG + Intronic
1061844474 9:133379331-133379353 ATGGTGGGAGGTGGTGGTGTTGG - Intronic
1061959123 9:133979114-133979136 CGTGCCAGGGGTGGTGGTGTCGG + Intronic
1061973075 9:134055140-134055162 CTTGCAAGTGGTGGTGGCGAGGG - Intronic
1061990143 9:134154320-134154342 GCGGCGAGGGGTGGTGGTGCTGG + Intronic
1062436186 9:136547555-136547577 CTGGTGGGTGGGGGTGGGGTGGG + Intergenic
1062602949 9:137327463-137327485 CTGGAAAGGGGTGGTGGTGATGG + Intronic
1203524008 Un_GL000213v1:68943-68965 CTGGCGCGGGGTGGGGGTGGAGG - Intergenic
1185895075 X:3850920-3850942 CTGGAGATAGGTGGTGGTGATGG + Intergenic
1185900193 X:3889345-3889367 CTGGAGATAGGTGGTGGTGATGG + Intergenic
1185905309 X:3927776-3927798 CTGGAGATAGGTGGTGGTGATGG + Intergenic
1186270255 X:7879023-7879045 CAGTGGAGTGGTGGTGGTGGTGG - Intergenic
1186997893 X:15143227-15143249 CTGGGGAATGGGGCTGGTGTTGG - Intergenic
1187119673 X:16392159-16392181 AGGGTGAGTGGTGGTGGTGGTGG - Intergenic
1187511664 X:19925209-19925231 TTGGGGAGTGGTGGCGGTGGTGG - Intronic
1190221542 X:48515342-48515364 CAGGCCAGTGATGGTGGTGGTGG + Intronic
1190960301 X:55240557-55240579 CTGGCCAACGGTGGTGGTGAAGG + Intronic
1191863281 X:65683424-65683446 CTGGGTGGTGGTGGTGGTGGTGG - Intronic
1192116080 X:68412548-68412570 CTGGAGATGGGTGGTGGTGATGG + Intronic
1192168520 X:68840718-68840740 CTGGCAAGGGGAGGGGGTGTGGG - Exonic
1192437061 X:71149386-71149408 CTGGCCAGAGGTAGTGGGGTGGG - Intronic
1193746633 X:85289788-85289810 CTAGCAAGAGGTGGGGGTGTGGG + Intronic
1195280782 X:103330700-103330722 CCGGCCTGTGGTGGTGGGGTGGG + Intronic
1195903586 X:109823037-109823059 CTCTGCAGTGGTGGTGGTGTGGG - Intergenic
1196044795 X:111246023-111246045 GTGGTGAGTGGTGGTGGTGGTGG + Exonic
1196357485 X:114810633-114810655 TGGGGCAGTGGTGGTGGTGTAGG + Intronic
1197035741 X:121871005-121871027 GTGGCCAGTGGTGTTGGGGTGGG - Intergenic
1197871118 X:131063709-131063731 CGGGGGAGGGGTGGTGGTGGTGG - Intronic
1198186475 X:134258411-134258433 TTGGCCAGGGGTGGTGGTGGTGG + Intergenic
1198646686 X:138815182-138815204 CTGGGGAGGGGTGATGGGGTTGG + Intronic
1199156180 X:144551394-144551416 ATGGCCTGTGGTGGTGGTGGTGG + Intergenic
1200122551 X:153798007-153798029 CTGGCGTGTGGGGGTGGGGAGGG - Intronic