ID: 1064956089

View in Genome Browser
Species Human (GRCh38)
Location 10:20911881-20911903
Sequence CTGCTTTTTAGAGCCTTTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064956089_1064956090 18 Left 1064956089 10:20911881-20911903 CCGTCAAAGGCTCTAAAAAGCAG 0: 1
1: 0
2: 0
3: 23
4: 213
Right 1064956090 10:20911922-20911944 AGTCTGTTGCAAAAATTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064956089 Original CRISPR CTGCTTTTTAGAGCCTTTGA CGG (reversed) Intronic
900404992 1:2489020-2489042 TTGCTTTTCAAAGCCATTGACGG + Intronic
901129546 1:6953705-6953727 CTGCACTTTATAGCCTTTTAAGG + Intronic
903169582 1:21543887-21543909 CTGCTTGGTAGAGCCTTGGAGGG + Intronic
903498608 1:23789347-23789369 CTGCATTTTAGAAATTTTGAGGG - Intergenic
904486504 1:30828149-30828171 CAGCCTTTTCCAGCCTTTGATGG + Intergenic
906574427 1:46875156-46875178 CTGCTTTTTAGCTGCTGTGAGGG - Intergenic
910525191 1:88169795-88169817 CTGATTTTTAGTGGCTTCGATGG + Intergenic
910579235 1:88803415-88803437 TTGCTTTGTAGAGCCTTAAAAGG + Intronic
910790309 1:91043646-91043668 ATGCTGTTTAGAACCTTTGGCGG + Intergenic
912944616 1:114074777-114074799 CTGCTCTTTAGCCCCTTTGAGGG + Intergenic
915909429 1:159904092-159904114 CTGCTTTGTTGGGCCATTGATGG + Intergenic
916293559 1:163191919-163191941 CTGCATTTTAGAGATTTTTATGG - Intronic
917118730 1:171627367-171627389 CTGCTTCTTAGAGTCCTTGTAGG + Intergenic
918556908 1:185813105-185813127 CTGCTTTTCAGAGCCTGACATGG + Intronic
923355282 1:233148957-233148979 CTCCTTTTTCTAGCCTTTCATGG - Intronic
1064952023 10:20863300-20863322 CTGCTTTTTTGTGCCTTTGCTGG - Intronic
1064956089 10:20911881-20911903 CTGCTTTTTAGAGCCTTTGACGG - Intronic
1065012577 10:21432801-21432823 CTGCCTTCTAGGGCCTCTGATGG - Intergenic
1066037689 10:31509368-31509390 CTGCATTGGAGAGCCTTTGCAGG + Intronic
1070846061 10:79523658-79523680 CTGCTTTTCTGAGCCTCTGGTGG + Intergenic
1070927736 10:80236652-80236674 CTGCTTTTCTGAGCCTCTGGTGG - Intergenic
1071267100 10:83974076-83974098 ATGCTGTTTGGAGCCTTTGGCGG - Intergenic
1077925100 11:6673793-6673815 CTGGTCTTTTGGGCCTTTGAGGG + Intergenic
1077986465 11:7356186-7356208 CTGCTTCTTCCATCCTTTGATGG - Intronic
1079456033 11:20637023-20637045 AGGCTTTTTAGACCCATTGAGGG + Intronic
1080276275 11:30506520-30506542 TTGCTTTTTAAAGGCTTTGTGGG - Intronic
1080864644 11:36182587-36182609 CTGCTTATTAGAGCATTTGCAGG + Intronic
1080965608 11:37210895-37210917 CTGCTTTTTACACACTGTGAGGG + Intergenic
1081063550 11:38510177-38510199 CTGCTGTTTAGAACCATTAAGGG + Intergenic
1084350126 11:68591183-68591205 CTGCTGATTTGAGCCATTGAAGG + Intronic
1086150087 11:83599483-83599505 ATGCTTTTTGGATCTTTTGAAGG - Intronic
1088594342 11:111428697-111428719 CTGCTGTTTGGAGCCATTCAGGG + Intronic
1089903595 11:122013507-122013529 ATGCTGTTTGGAGCCTTTGACGG + Intergenic
1090158657 11:124467998-124468020 CTGCTTTTGATAGAGTTTGAGGG + Intergenic
1090502853 11:127278704-127278726 TTGCATTTTACAGCCTTGGAGGG + Intergenic
1092027870 12:5258162-5258184 TTCCTTTTTGGAGGCTTTGAGGG + Intergenic
1095078697 12:37968828-37968850 CTGTTTTTTAGAATCTGTGAGGG + Intergenic
1095569617 12:43669534-43669556 CTGCCTTTTCCAGCCTCTGATGG - Intergenic
1097293623 12:57941371-57941393 CGGGTTGTTACAGCCTTTGAGGG + Intergenic
1097857042 12:64474344-64474366 CTGCCATTTAGACCCTTTGAAGG + Exonic
1098381124 12:69870653-69870675 CTTCTTTTCAGAGAATTTGAAGG - Intronic
1098749832 12:74279492-74279514 ATGCTGTTTGGAGCCTTTGGAGG + Intergenic
1099381025 12:81952550-81952572 CTGCTCTTTGGAGCCATTCATGG + Intergenic
1100192583 12:92208833-92208855 ATGCTTTATAGAGCTGTTGAAGG + Intergenic
1101800928 12:108021462-108021484 ATGCTTTTGAGAGCCAGTGATGG - Intergenic
1103176184 12:118865483-118865505 CTGTCTTTTAGGGCCTCTGAGGG - Intergenic
1106769594 13:32949024-32949046 CTGCTTTTTAGTGGCTTTACTGG - Intergenic
1108090111 13:46840676-46840698 CTGCTTATTTGTTCCTTTGAAGG + Intronic
1108352526 13:49600057-49600079 CAGCTTTTTAGTGACTTGGATGG - Intergenic
1108763903 13:53603540-53603562 ATTCTTTTTAGAGCTTTTGAAGG + Intergenic
1109610051 13:64753071-64753093 CTGCTGTTCAGAGCTTGTGAGGG - Intergenic
1109640705 13:65187796-65187818 CTGCATTTAAGAGCATTTGAGGG - Intergenic
1110316595 13:74115393-74115415 TTCTTTTCTAGAGCCTTTGAAGG - Intronic
1112100309 13:96181576-96181598 CTGCTTTTCAGAGCTCTTGCTGG + Intronic
1115525342 14:34274593-34274615 ATACTTTTTAGACCCTCTGAGGG - Intronic
1116680509 14:47963327-47963349 CTGCTTTTTAGAGCCATCTAAGG + Intergenic
1122077359 14:99245136-99245158 CTGCTTTTCTGGGCCTTTAAGGG + Intronic
1123928628 15:25144743-25144765 GTGCTTTGAAGAGCCTTTGACGG + Intergenic
1124090456 15:26595099-26595121 CTTCTCTTTTGAGCCTTAGATGG + Intronic
1124639765 15:31390343-31390365 CTGCTTTTTTGAGTCCTTGGAGG + Intronic
1125315346 15:38425595-38425617 CTGCCTTCTGGAGGCTTTGAGGG - Intergenic
1125406088 15:39353756-39353778 TTGCTTCTTTGAGCCTTTGCTGG + Intergenic
1128757108 15:70190557-70190579 CTGCTGTTTGGAGCCATCGAGGG - Intergenic
1128849239 15:70935157-70935179 ATGATTTTTAGAGCTTTTCATGG - Intronic
1133474353 16:6106072-6106094 TTACTTTTAAGAGCCATTGAAGG - Intronic
1134059114 16:11188368-11188390 GTTCTTTTAAAAGCCTTTGATGG - Intergenic
1136742000 16:32542457-32542479 CTGTTTTTTAGAATCTGTGAAGG + Intergenic
1136742120 16:32544511-32544533 CTGTTTTGTAGAACCTTTGAAGG + Intergenic
1138338825 16:56274443-56274465 CTGCTTTTTAGAGAAATTCAGGG + Intronic
1138574093 16:57896108-57896130 CTGCTTTTAGCATCCTTTGATGG - Intronic
1140904091 16:79395676-79395698 TTGCTTTTTGGAGACTCTGAAGG - Intergenic
1141629017 16:85276834-85276856 CTGCTTTTCAGAGCCCTGGTGGG - Intergenic
1203027480 16_KI270728v1_random:530722-530744 CTGTTTTGTAGAACCTTTGAAGG - Intergenic
1203027603 16_KI270728v1_random:532777-532799 CTGTTTTTTAGAATCTGTGAAGG - Intergenic
1203044118 16_KI270728v1_random:801654-801676 CTGTTTTTTAGAATCTGTGAAGG + Intergenic
1203044241 16_KI270728v1_random:803709-803731 CTGTTTTGTAGAACCTTTGAAGG + Intergenic
1150121977 17:62611429-62611451 TTGCTTTTTAGAGCATTTTTAGG + Intronic
1150895417 17:69204655-69204677 CTGCTTATTGAAGCCTATGATGG - Intronic
1153417906 18:4870051-4870073 CTGCTTTTGAGAGTCTTTCTAGG - Intergenic
1155977955 18:32152214-32152236 GTGCTCTTGAGAGCCTTTAAAGG + Intronic
1157052640 18:44185255-44185277 CTGCCTTTAAGAGCTTTTAATGG + Intergenic
1157315920 18:46589582-46589604 ATGCTGATTAGAGTCTTTGAGGG - Intronic
1159617302 18:70596369-70596391 CTGCTATTTAGATCCTTTGTGGG + Intergenic
1160514928 18:79472938-79472960 CTGCGTTTTAGGCCCTTGGAGGG - Intronic
1161129165 19:2578179-2578201 CTGATTCTTAGGGGCTTTGAGGG + Intronic
1161796705 19:6391235-6391257 GTCCTTTCTAGAGCCTCTGATGG + Intronic
1164339501 19:24374631-24374653 CTGGTTTTTAGTGTCTGTGAGGG + Intergenic
1164375576 19:27680810-27680832 CTGCTTTGTAGAATCTGTGAAGG - Intergenic
1166623065 19:44322279-44322301 CTGCTGTTGAGAGCCTCTAATGG + Intergenic
1166716923 19:44974384-44974406 CTGCTCTTCAGAGCCTCTGCAGG - Intronic
1167532581 19:50027321-50027343 CTGGTTTTTGGAGCATTTAAAGG + Intronic
925325470 2:3018191-3018213 CTGCTTATTAGAGGCTAGGAAGG + Intergenic
930017870 2:46983328-46983350 CTGCTTTTTTGATCCTTTTTCGG + Intronic
931214258 2:60226591-60226613 TTGCTTCTTACAGCCTTTGGTGG + Intergenic
931968022 2:67554975-67554997 CTGCTATTTAGGGCTTTTGTAGG - Intergenic
932103702 2:68924092-68924114 CTGCTTGTGAGAGCTTGTGAGGG - Intergenic
932219090 2:69986484-69986506 CTGAGTTATAGAGCCTTTGTAGG - Intergenic
935403897 2:102688282-102688304 CTGCTTTTTGCAGCCTCTGTGGG + Intronic
935736455 2:106110412-106110434 CTGCTTCTTGGAGGCTTTCATGG + Intronic
936780250 2:116023937-116023959 TTGCTTTTTAGTGCCATTGCAGG + Intergenic
938976914 2:136487523-136487545 CTGTTTTTTAAAGCATCTGAGGG - Intergenic
939523609 2:143263729-143263751 CTGCTCTTTAGAGGCCTGGAAGG - Intronic
942715937 2:178892233-178892255 CTTCTATTTAAAGCCTTAGAGGG + Intronic
943799877 2:192044675-192044697 ATGCTGTCTGGAGCCTTTGATGG + Intronic
946118402 2:217485086-217485108 ATGCATGTTAGAGCTTTTGATGG - Intronic
947562036 2:231163306-231163328 CTCCTTTGTAAAGCATTTGATGG - Intronic
1168920989 20:1536165-1536187 CTGGTTGTTACAGCCTTTTAGGG - Intronic
1170976021 20:21165489-21165511 ATGCTTTGTAGAGCTGTTGAAGG + Intronic
1175534268 20:59696801-59696823 CTGCTTTTGGGAGACCTTGAAGG + Intronic
1178117527 21:29432689-29432711 CTGCTTGTGATGGCCTTTGATGG + Intronic
1178264449 21:31129775-31129797 ATGCTTTTTAGTGCTTTTGGTGG + Intronic
1178389040 21:32183624-32183646 CTGCTTTTCAGAGCCAGTGAAGG + Intergenic
1182134007 22:27883712-27883734 GTTCTTTTTAGAGCCCCTGAGGG - Intronic
1184847682 22:47099178-47099200 CTGCTCTTCAGAGCCTTAGATGG + Intronic
1184912636 22:47546657-47546679 CTGCTATTAAGAGCCTTGGCTGG + Intergenic
949254244 3:2026051-2026073 CTACTTTTTATTGCCTTTCAGGG - Intergenic
951122555 3:18945464-18945486 ATGCTGTTTGGAGCCTTTGGTGG + Intergenic
951173013 3:19564899-19564921 CTGATTTTTAAAGCCTTGGGTGG - Intergenic
951181767 3:19667844-19667866 CTGATTTTTAGTTCCTATGAAGG - Intergenic
953840105 3:46383253-46383275 CTCCTTTTGAAAGCCTTTTAGGG + Intergenic
956691627 3:71883543-71883565 CTACTTTTCAGAGTCCTTGAAGG + Intergenic
957934327 3:86923073-86923095 CTGCTTGTTTTAACCTTTGAAGG - Intergenic
958534951 3:95388234-95388256 TTGCTTTTTAGAACTTTTGATGG + Intergenic
959371204 3:105528278-105528300 CTGATTTTTAGATTCTTTGAAGG + Intronic
959669908 3:108964793-108964815 CTGCTATTTAGTGCCTTTCTTGG - Intronic
960258934 3:115543341-115543363 ATGCTTAATAGAGCCATTGAGGG - Intergenic
961562397 3:127739790-127739812 CTGCTTCTTTGAGGCTTTGGGGG + Intronic
962563346 3:136631705-136631727 ATGTTTTTTAGAGCCATTGTAGG - Intronic
963740532 3:149075793-149075815 CTTCTTGTTAGAGCCTATAAAGG - Intronic
964551779 3:157892650-157892672 CTGCTTGTTAGATGCTTTCATGG - Intergenic
965132382 3:164717628-164717650 CTGCTTTCTGAAGCTTTTGACGG - Intergenic
966730219 3:183144687-183144709 CTGGTCTCCAGAGCCTTTGAGGG - Intronic
966980935 3:185134752-185134774 TACCTTTTTAGAGCCTTTCAAGG - Intronic
967673199 3:192263860-192263882 CTGCATTTATGAGCCTTAGAGGG - Intronic
969995138 4:11304314-11304336 CTGTGTTTAAGAGTCTTTGAGGG - Intergenic
971230484 4:24797088-24797110 CTCCTTCTTGGAGCCTTTCAAGG + Intronic
974008070 4:56580025-56580047 CTGATTTTTTGAGAGTTTGAAGG - Intronic
975280639 4:72558322-72558344 CTGCTTTTTCCAGCTTTTGGAGG + Intronic
975718557 4:77228592-77228614 CTTCATTTTGGAGACTTTGAAGG + Intronic
976651814 4:87443659-87443681 CTGCTTTATAAAGCCTTTCTTGG - Intronic
979020795 4:115494551-115494573 CTGCTTTTTAGGCTCTTTGCAGG + Intergenic
981527172 4:145718523-145718545 CTGCTTTTTGAAGTCTTTCAAGG - Intronic
981856215 4:149296179-149296201 CTTCTTTTTCCAGCCTTTGGAGG + Intergenic
981979373 4:150772707-150772729 ATGCTATTTGGAGCCTTTGACGG - Intronic
984592942 4:181636814-181636836 CTTCTGTTTAGAGCCCCTGATGG + Intergenic
985077527 4:186231154-186231176 CTATTTTTTATTGCCTTTGAGGG - Intronic
985122876 4:186661457-186661479 CTGCTTTCTTGGGCCTTTTATGG - Intronic
985530326 5:430297-430319 CTGTTCTTTGGCGCCTTTGACGG + Intronic
986437094 5:7745163-7745185 CCACTTTTCAGAGCTTTTGAAGG - Intronic
986572645 5:9181388-9181410 ATGCTGTTTAGTGCTTTTGAAGG - Intronic
986606718 5:9530014-9530036 CTGCTCTTCAGAGCCTGTGCTGG - Intronic
987512261 5:18855607-18855629 GAGCTTTCTAGAGCCTTGGAGGG + Intergenic
988169216 5:27632940-27632962 ATGCTGTTTGGAGCCTTTGGTGG - Intergenic
989486399 5:41996460-41996482 ATGCTGTTTGGAGCCTTTGCAGG - Intergenic
989838495 5:46028228-46028250 CTGTTTTGTAGAACCTGTGAAGG + Intergenic
989853691 5:46250482-46250504 CTGCTTTGTACAGTCTGTGAGGG - Intergenic
990309144 5:54521071-54521093 CTGCCTTTGTGAGCCTTTAATGG + Intronic
991033528 5:62105819-62105841 ATGCTGTTTGGAGCCTTTGGCGG + Intergenic
992939016 5:81743515-81743537 CTGCTTTCATGAGACTTTGAAGG - Intronic
995714041 5:115064342-115064364 CTGCTTTTTAGAGGTTTTCAGGG + Intergenic
997041059 5:130255061-130255083 CTGATTTTTAGTGCATTTTATGG - Intergenic
997422743 5:133782027-133782049 CTGTTTTCCACAGCCTTTGATGG - Intergenic
997579299 5:135007217-135007239 TTGCTTCTTTGAGCCTCTGACGG + Intronic
1000784898 5:165530765-165530787 CAGCTTTTAAGAGCTTTTAAGGG + Intergenic
1001481968 5:172094854-172094876 TTGTTTTTTAGAGTCTTTGTTGG + Intronic
1002915020 6:1522147-1522169 CTGATTTTCAGAGATTTTGAGGG - Intergenic
1004414161 6:15409548-15409570 CTGCTTTTTAGAGCCCCCAAGGG + Intronic
1005091964 6:22066587-22066609 CTTCATTTTGGAGCCCTTGATGG - Intergenic
1005237554 6:23782691-23782713 TTCCTTTATAGAGCATTTGAAGG + Intergenic
1007896281 6:45362866-45362888 CTTCTATTTAGTGCATTTGATGG - Intronic
1013490202 6:110639379-110639401 CTCCTTTGTAAAGTCTTTGAAGG + Intronic
1013970187 6:116008671-116008693 CTGCCTTTTAGAGCCTCTGCTGG + Intronic
1014828129 6:126069742-126069764 CTGGTTATTGGAGACTTTGAAGG + Intergenic
1016395217 6:143617024-143617046 CAGCTTTCAGGAGCCTTTGAAGG + Intronic
1016739992 6:147516693-147516715 ATGCTGTTTAAAGCCTTTGCTGG - Intronic
1020545648 7:9526631-9526653 CTGATATTTATAGTCTTTGATGG - Intergenic
1025531977 7:61899081-61899103 CTGTTTTGTAGATCCTTTGAAGG + Intergenic
1025576873 7:62656211-62656233 CTGCTTTCTAGAATCTGTGAAGG - Intergenic
1026669234 7:72372978-72373000 TTGCTTTTTGGAGCATTTTATGG - Intronic
1030179768 7:106693789-106693811 GTGGTTTTAAGAGCTTTTGAAGG + Intergenic
1030452294 7:109727649-109727671 ATGCATTTTAGGGCCTCTGAAGG + Intergenic
1030607755 7:111656057-111656079 CTGCTTTAAAGAGAGTTTGAAGG + Intergenic
1032027079 7:128452085-128452107 CTTCTTTTTAGGGGCTTTGGGGG + Intergenic
1035397360 7:158543968-158543990 CTGGTTTTTGGACCCTTTGGAGG - Intronic
1035473358 7:159125627-159125649 CTGCTTTCTGGAGCCTTCAAGGG + Intronic
1036049716 8:5183100-5183122 ATGCTGTTTTGAGTCTTTGATGG + Intergenic
1036667007 8:10752850-10752872 CTTCTTCTCAGAGCCTTAGATGG + Intronic
1038305039 8:26392604-26392626 GTGCTTCTTAGAGCCTGGGATGG + Intronic
1039870790 8:41543549-41543571 TTGCTTTTTATAGCATTTCAAGG - Exonic
1040115702 8:43616367-43616389 CTGTTTTGTAGAATCTTTGAAGG + Intergenic
1040776260 8:51046376-51046398 CTTTTTTGTAGGGCCTTTGAGGG + Intergenic
1041083806 8:54238478-54238500 TTGCTTTTCAGAGCCTCTAAGGG + Intergenic
1042147582 8:65746524-65746546 TTGGTTTTTAGGGCCTTTGTGGG - Intronic
1043534912 8:81192215-81192237 CTGCTTATTAGAGGCTGTGGAGG + Intergenic
1044526707 8:93260561-93260583 CTGCCTTTTACATACTTTGAAGG - Intergenic
1044740396 8:95320797-95320819 TTGCTTTTAAGAGGCTTTTAAGG + Intergenic
1044815145 8:96104363-96104385 CTGATTTTTACAGCTTTTCAAGG + Intergenic
1044860933 8:96523236-96523258 TTGCTTTTTAGAGGATTTGGTGG + Intronic
1045424249 8:102047933-102047955 CAGCTTTTGAGAGGGTTTGAAGG + Intronic
1045610134 8:103830282-103830304 CTTCTTTTTAAAGCTTTGGAAGG + Intronic
1046266134 8:111832535-111832557 CTGCTTTCTAGAAGCTTTAAGGG - Intergenic
1047828319 8:128603411-128603433 CTGCTTTTGAGAGCTGTTAATGG - Intergenic
1050171235 9:2819472-2819494 ATGCTTCTTAGAGCTTTTGTAGG - Intronic
1051069628 9:13149242-13149264 CTGTCTTTGAGAGCCTTAGACGG - Intronic
1054878199 9:70118506-70118528 TTCCTTTTTAGAGCATTGGAGGG - Intronic
1055915297 9:81394369-81394391 CTGATTTTCAGAGCATTTTATGG - Intergenic
1056428538 9:86503564-86503586 CTGCCCCTTAGAACCTTTGATGG + Intergenic
1057037557 9:91822516-91822538 CTGCTTTTGAGAATCATTGATGG - Intronic
1059214697 9:112550165-112550187 TGGCTGTTTGGAGCCTTTGATGG + Intronic
1060371442 9:123076649-123076671 CTGCTGTTGACAGACTTTGAAGG + Exonic
1061131729 9:128712355-128712377 CTGCTTTCTCTACCCTTTGAGGG + Intronic
1185864529 X:3611670-3611692 TTACTTCTTTGAGCCTTTGAAGG - Intronic
1186089684 X:6032068-6032090 CTGCCTTTTACAGCATTTAAGGG - Intronic
1186177732 X:6942889-6942911 CTCCTTCTTAGAGCCTTTAGAGG + Intergenic
1186254726 X:7706298-7706320 TTTTTTTTTAGAACCTTTGAAGG - Intergenic
1186779024 X:12894307-12894329 CTGCTTCTGAGACCCTTAGACGG + Intergenic
1187020179 X:15373442-15373464 CAGCTTTTTAAAGCCTTGGAAGG - Intronic
1188105129 X:26139888-26139910 CTGCTATGAAGAGGCTTTGAGGG + Exonic
1188398086 X:29709637-29709659 TTGCTTTTTGGAGTCTTTGCTGG + Intronic
1189283364 X:39834742-39834764 CTGCTTTGTATAGACTTTAAAGG - Intergenic
1190263269 X:48812816-48812838 CTGCTGTTTATTGACTTTGATGG + Intronic
1190366472 X:49699107-49699129 CTGCAATTTAGGGCCTTTCAGGG + Intergenic
1191268752 X:58433894-58433916 CTGTTTTTTAGAATCTGTGAAGG - Intergenic
1191577910 X:62727041-62727063 CTCCTTTGTAGAGGCTCTGAAGG - Intergenic
1192297725 X:69868120-69868142 ATGCTGTTTGGAGCCTTTGGCGG - Intronic
1193260213 X:79397332-79397354 CTCCTTTTTAGGGCCTATTACGG + Intergenic
1193529588 X:82641037-82641059 CTGCTGTTGAGAGACTCTGATGG + Intergenic
1193732175 X:85115112-85115134 CTGTTTTTTCAAGCATTTGAAGG - Intergenic
1193787501 X:85777602-85777624 CTTCTTTTCAGGGCCTTAGATGG + Intergenic
1193986670 X:88251426-88251448 CTGCTATTAAGAGACTCTGATGG + Intergenic
1194783972 X:98058794-98058816 CTGATTTTTGGTTCCTTTGAAGG + Intergenic
1194849866 X:98857183-98857205 CTGTTTTTGCGAGCATTTGAAGG + Intergenic
1195090260 X:101451545-101451567 CTGATTTTTAGTTCTTTTGAAGG + Intronic
1197404383 X:126030977-126030999 CTTCTTTTTAGATTCATTGATGG + Intergenic
1197721477 X:129747631-129747653 CTGTCTGTTAGAGCCTTGGAGGG - Exonic
1198217100 X:134565524-134565546 GTGCTTCTTAGAACCATTGATGG + Intergenic
1201924295 Y:19267968-19267990 CTGGTTTTTTGAGCATATGAAGG - Intergenic