ID: 1064958416

View in Genome Browser
Species Human (GRCh38)
Location 10:20937331-20937353
Sequence GATGCTTATTTTAAGTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064958416_1064958422 17 Left 1064958416 10:20937331-20937353 CCTCCCAACTTAAAATAAGCATC No data
Right 1064958422 10:20937371-20937393 TGAGAGATGTAGGAGAAAACAGG No data
1064958416_1064958419 7 Left 1064958416 10:20937331-20937353 CCTCCCAACTTAAAATAAGCATC No data
Right 1064958419 10:20937361-20937383 ATCATTCCCATGAGAGATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064958416 Original CRISPR GATGCTTATTTTAAGTTGGG AGG (reversed) Intronic
No off target data available for this crispr