ID: 1064959772

View in Genome Browser
Species Human (GRCh38)
Location 10:20950925-20950947
Sequence TTGCATCCTTAGAATTATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064959772_1064959774 19 Left 1064959772 10:20950925-20950947 CCTTTATAATTCTAAGGATGCAA 0: 1
1: 0
2: 0
3: 17
4: 175
Right 1064959774 10:20950967-20950989 AATGGTTAAATATTCCTTTGTGG No data
1064959772_1064959776 29 Left 1064959772 10:20950925-20950947 CCTTTATAATTCTAAGGATGCAA 0: 1
1: 0
2: 0
3: 17
4: 175
Right 1064959776 10:20950977-20950999 TATTCCTTTGTGGCCTGGTATGG No data
1064959772_1064959775 24 Left 1064959772 10:20950925-20950947 CCTTTATAATTCTAAGGATGCAA 0: 1
1: 0
2: 0
3: 17
4: 175
Right 1064959775 10:20950972-20950994 TTAAATATTCCTTTGTGGCCTGG No data
1064959772_1064959773 1 Left 1064959772 10:20950925-20950947 CCTTTATAATTCTAAGGATGCAA 0: 1
1: 0
2: 0
3: 17
4: 175
Right 1064959773 10:20950949-20950971 GATACAAAGCTTAATTCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064959772 Original CRISPR TTGCATCCTTAGAATTATAA AGG (reversed) Intronic
901103166 1:6735167-6735189 TTGAATCCACAGTATTATAAAGG - Intergenic
903409095 1:23125218-23125240 TGGCATCGTTAAAATTAAAATGG + Intronic
906957378 1:50386200-50386222 TTGCATCCTTTAAATCATTAAGG - Intergenic
908877690 1:68696789-68696811 ATCCTTCCTTAGAATTATCAGGG - Intergenic
909175299 1:72349838-72349860 TTGCATGCTTTGAATTATATAGG + Intergenic
911885631 1:103295537-103295559 ATGCATCCTCAGAAGTATTATGG + Intergenic
914289603 1:146260829-146260851 TGGCATCCATTGATTTATAAGGG - Intergenic
914550639 1:148711582-148711604 TGGCATCCATTGATTTATAAGGG - Intergenic
914773581 1:150715180-150715202 TTGCATCCTAATTATTATGATGG - Intronic
914865935 1:151428662-151428684 TTGTATTCTTAGAATTAAAAAGG - Intronic
916661604 1:166926950-166926972 TTGCAGGCTTAGAATTAGCAGGG - Intronic
917675190 1:177312062-177312084 TTGCATCCATACATTTTTAATGG - Intergenic
1063756140 10:9011079-9011101 TGGCATACTTGGAATTATAACGG - Intergenic
1064959772 10:20950925-20950947 TTGCATCCTTAGAATTATAAAGG - Intronic
1066048296 10:31613419-31613441 TTTTTTCCTTTGAATTATAAGGG - Intergenic
1066706110 10:38179985-38180007 TTGATTCCTTTAAATTATAATGG + Intergenic
1071792087 10:88965656-88965678 TTGGATGCTTTGCATTATAATGG - Intronic
1074636350 10:115322926-115322948 TTTCATCATTTTAATTATAATGG + Intronic
1074688094 10:115978227-115978249 GAACAGCCTTAGAATTATAAAGG + Intergenic
1076562240 10:131374860-131374882 TTGCATCCTGAGGATCGTAAAGG + Intergenic
1076562709 10:131377394-131377416 TTGCATCCTGAGGATTGTAAAGG - Intergenic
1077475150 11:2784268-2784290 TTTCCTCCTTTGAATTATCATGG + Intronic
1078856851 11:15212960-15212982 TTTAATCCTTAAAATAATAATGG - Intronic
1078908821 11:15712156-15712178 TGGCAACTTTAGAATTATAAAGG - Intergenic
1080519490 11:33055156-33055178 TGGCATTTTTATAATTATAATGG - Intronic
1080936380 11:36868344-36868366 CAGCATCCTGAGAGTTATAATGG + Intergenic
1085236210 11:75017488-75017510 TTGCAGCCTTATAATTGCAAGGG - Intronic
1086121327 11:83307108-83307130 TTGCTTCCTTAGAAATAAAAAGG + Intergenic
1087824884 11:102753849-102753871 TTTGATCCTTAAAATGATAAAGG + Intergenic
1087872005 11:103306612-103306634 GTGCTTGCTTAAAATTATAAAGG - Intronic
1089897217 11:121942808-121942830 TTGCCTACATAGAATAATAATGG + Intergenic
1090526307 11:127541550-127541572 TTTTATCATTAAAATTATAAAGG - Intergenic
1091863630 12:3810100-3810122 TTGAATCATTTGAATTAGAAAGG - Exonic
1093688259 12:22081108-22081130 TTGCATCTGTAGAATTAGAAGGG - Intronic
1095232853 12:39762327-39762349 TTAAATCCTTAGAAGAATAAAGG - Intronic
1096040362 12:48509959-48509981 TAGAATCTTTAGAATTAAAAGGG + Intronic
1099140036 12:78961435-78961457 TTGCATCATTAGAATTTAAGAGG - Intronic
1099566977 12:84263768-84263790 GAGCAATCTTAGAATTATAAGGG + Intergenic
1099723587 12:86396532-86396554 TTGGCTACTTATAATTATAATGG + Intronic
1099875255 12:88396543-88396565 TTGCATCCCTATAATAATACTGG - Intergenic
1100366567 12:93926539-93926561 TTGCATCCGTAAAATTAGAATGG - Intergenic
1101966692 12:109286995-109287017 TTGCATCCCCATAATTTTAATGG + Intronic
1102131751 12:110536401-110536423 TTCCATCCATAGAACTAAAATGG + Exonic
1104316077 12:127702924-127702946 TTTCATCCTTAGGGTAATAAAGG - Intergenic
1108762494 13:53586399-53586421 TTGTATTTTTAGAATTTTAATGG + Intergenic
1110913586 13:80993957-80993979 TTGCATTGTTATAATTATATGGG + Intergenic
1111746162 13:92272230-92272252 TTCCATCCTTAGATTTTTACAGG - Intronic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1112744495 13:102511389-102511411 GTACATCCTAAGTATTATAAGGG + Intergenic
1114986461 14:28235922-28235944 TTGCTTCTTTAGAAATATAATGG + Intergenic
1115793300 14:36904373-36904395 TTGCAACCTTTGAAATTTAAGGG - Intronic
1116273478 14:42801674-42801696 TTGCCTAGTTAGAATTGTAAAGG + Intergenic
1116955226 14:50916471-50916493 TTCCATCCTTAGAGTTTTATAGG - Intronic
1118073558 14:62272602-62272624 TTTCATCATTAAAATTATTAAGG + Intergenic
1119873143 14:78033919-78033941 ATCCATGCTTAAAATTATAAGGG - Intergenic
1119993313 14:79224695-79224717 TTGTATCCTTATAATAAAAAGGG + Intronic
1124390206 15:29248436-29248458 TTGAATCCTTTGACTTATATTGG - Intronic
1126345436 15:47688997-47689019 TTGAATCATTACAAATATAATGG + Intronic
1127147964 15:56044334-56044356 TTGCATATTTAGAAATATGAGGG + Intergenic
1127167099 15:56255685-56255707 TTATATTCTTAGATTTATAAAGG - Intronic
1127182077 15:56431702-56431724 TTGCCTCCTTGTAATTTTAAAGG - Intronic
1129922687 15:79333476-79333498 TAGCATCTCCAGAATTATAATGG - Intronic
1133839951 16:9398885-9398907 TTGCCTGCTTAGAATGGTAATGG - Intergenic
1134177772 16:12022141-12022163 TTGTATACTTACAATTTTAACGG - Intronic
1137905332 16:52315956-52315978 AAGCATCCTTAGGATTATGAGGG + Intergenic
1139180146 16:64737573-64737595 TTACATTCTTAGATTTATATAGG + Intergenic
1144403385 17:14928680-14928702 TTGCATTTTTAGAATAATCACGG - Intergenic
1144542822 17:16161194-16161216 TTTTAGCCTTTGAATTATAATGG - Intronic
1145742388 17:27286261-27286283 ATGCATCCTTAGACTTAGCATGG + Intergenic
1145867977 17:28252999-28253021 ATGGATCCTTAGGAATATAAAGG - Intergenic
1146128783 17:30251794-30251816 TTACATTCTTAAAATTATTAGGG + Intronic
1146664622 17:34690219-34690241 TTGAATCCATAGAATTAACAGGG - Intergenic
1149086608 17:52724950-52724972 TTGCATATTTGGTATTATAATGG - Intergenic
1149396658 17:56252151-56252173 TCACAACCTTAGATTTATAAAGG - Intronic
1155914337 18:31541273-31541295 CTGCATCCTTGGAATAATGAAGG + Exonic
1157778367 18:50416202-50416224 TTGCATATTTATATTTATAATGG + Intergenic
1157850841 18:51048876-51048898 TTTCATCCTAAGAAACATAAAGG + Intronic
1158152394 18:54387494-54387516 TTTCATCCTTGGACTTCTAAGGG - Intergenic
1163239185 19:16048975-16048997 TTGCATCCTTAAAAAAAAAAGGG + Intergenic
930252180 2:49047084-49047106 TCACATCCTTAAAATTAGAATGG + Intronic
932143011 2:69296129-69296151 TTTAATCCTTACACTTATAAAGG - Intergenic
932516437 2:72354916-72354938 TTGGATCCTTAGATCTAAAATGG - Intronic
933167656 2:79093756-79093778 CTACATCCTTAGAAATAAAATGG - Intergenic
933882639 2:86685894-86685916 TTGCATCTTTATATTTAAAATGG + Intronic
933985500 2:87588754-87588776 GAGCAACCTTACAATTATAATGG + Intergenic
934864970 2:97800161-97800183 TTGCAGTCTTAAAATTATTAAGG - Intronic
941567917 2:167131506-167131528 TTGCTTCCTTGGAAGTACAAAGG - Intronic
941853187 2:170204808-170204830 TTGCCTTCTTACAATTCTAAAGG + Intronic
942208163 2:173644245-173644267 TTGCATCCTTGGTATTTTCAAGG + Intergenic
943510559 2:188821082-188821104 TTTCATCATTACTATTATAAAGG + Intergenic
944317712 2:198301057-198301079 ATTCATCCTCAGAACTATAATGG + Intronic
944534854 2:200698519-200698541 TTACACCCTTAAAATTATTAAGG + Intergenic
944681388 2:202080236-202080258 TTGCTTTCCTAGAATTACAAAGG - Intronic
945638453 2:212390033-212390055 TTTCCTCCTTAGTAATATAATGG + Intronic
946134033 2:217630956-217630978 ATGCATACTTAGATTAATAATGG - Intronic
946698039 2:222381416-222381438 TTGCATTTTTATAATTCTAAAGG - Intergenic
1170045058 20:12076172-12076194 TACTTTCCTTAGAATTATAAAGG + Intergenic
1170056425 20:12209913-12209935 TTACATTCTTCGAATTAGAAGGG + Intergenic
1170307136 20:14950950-14950972 TTGCAAATTTAGAATTAGAAGGG + Intronic
1173672222 20:44806506-44806528 TTGCATCATTACAGTTATTAAGG - Intronic
1177300814 21:19243858-19243880 ATGCAGCCTTAGAAGAATAAAGG - Intergenic
1178598161 21:33973397-33973419 TAGCATCCTTAGAGTTATCGGGG + Intergenic
1179318145 21:40264367-40264389 CTGCATCTTTAGAATTATCATGG - Intronic
953765081 3:45733936-45733958 TTGAATTCATAGAATTATCAAGG + Intronic
954963497 3:54588260-54588282 TTGTATTTTTAAAATTATAAAGG - Intronic
956240254 3:67122272-67122294 TTTTATCATTAAAATTATAAAGG - Intergenic
957143494 3:76391887-76391909 TTGCATCATTATAATTTTCAAGG - Intronic
958854131 3:99363992-99364014 TTCCTTCCTTAGAAATATTAAGG - Intergenic
959772374 3:110114421-110114443 TTGCATCCTTAAAATGCTGATGG + Intergenic
959922740 3:111886544-111886566 TTGTAACCTTTGGATTATAATGG + Intronic
963977596 3:151498990-151499012 TTGCATATTAAGAATTTTAAAGG - Intergenic
964240535 3:154588104-154588126 TTTTATCCTTAGAATTACAGTGG - Intergenic
964568360 3:158083545-158083567 TTGCATCTTTATAATAAAAAAGG - Intergenic
965962239 3:174441874-174441896 TTGCATCCTGAGGAGTGTAAAGG + Intronic
966185315 3:177221704-177221726 TGGCATCCATGGAATAATAATGG + Intergenic
967815355 3:193793701-193793723 TGGGATCCTTAGAATTTTTAGGG + Intergenic
970362023 4:15319584-15319606 TTGCATCTGTAGAATAATAATGG - Intergenic
971580346 4:28330841-28330863 TTGAATACTCAGCATTATAAAGG - Intergenic
972135585 4:35889047-35889069 TTTCTTACATAGAATTATAATGG - Intergenic
977168706 4:93732843-93732865 TTGTTTTCTTAGAATTATTATGG - Intronic
977304418 4:95304735-95304757 GTGTTTCCTTAGAACTATAATGG + Intronic
977574579 4:98662704-98662726 TTTCAACCTCAGAGTTATAAGGG - Intergenic
980999580 4:139816014-139816036 TGGCAGTCTTAGAATTATATTGG - Intronic
981033367 4:140148180-140148202 CTGTCTCATTAGAATTATAAGGG - Intronic
981677113 4:147354994-147355016 TTGCATGCTTAAAAGTCTAAGGG - Intergenic
981737517 4:147968329-147968351 TTACATCCTTATAAAAATAAAGG - Intronic
982225589 4:153163145-153163167 TTGCTTCTCTAAAATTATAATGG + Intronic
982886637 4:160789878-160789900 TTGTATCCTGAGACTTCTAATGG - Intergenic
983258037 4:165424075-165424097 TTGCCTACTTAGACTTCTAAAGG + Intronic
983825559 4:172254375-172254397 TTGTATCATTAGAATTTCAAAGG - Intronic
988204096 5:28112037-28112059 TTGCATCTTTAAGATTGTAACGG + Intergenic
990330282 5:54719146-54719168 ATACATACATAGAATTATAAAGG - Intergenic
992721157 5:79562494-79562516 TTGTATTCCTAAAATTATAATGG + Intergenic
993526972 5:88976966-88976988 TTGAATCCTTAGCATTTAAATGG + Intergenic
993744390 5:91578298-91578320 TTACATCTTTTGAATTATCAAGG + Intergenic
994007602 5:94857938-94857960 TTGGATCCATATAATTTTAAAGG + Intronic
994705369 5:103198143-103198165 TTGCATATTTAGAAGTATATTGG + Intronic
994760978 5:103853729-103853751 TTGCATCCCTAAGATTATAGAGG + Intergenic
999381887 5:151127096-151127118 TTTCTTCCTTAGAATTTGAATGG + Intronic
999396363 5:151231442-151231464 TTGAGTCCTTAGAATTCTACTGG + Intronic
1000154026 5:158533218-158533240 TTGTATCCTTTGTCTTATAAAGG + Intergenic
1000657082 5:163892558-163892580 TTGCTTCATTAGAAGTATAAGGG - Intergenic
1000671622 5:164070314-164070336 TTCCATCCTGAGGATAATAAAGG + Intergenic
1000844159 5:166258126-166258148 TAGCATGCTTAAAATTAAAAAGG + Intergenic
1000951715 5:167492020-167492042 TTGCATTATTAGTATTTTAAAGG + Intronic
1003048625 6:2760548-2760570 TTGCTTCATTAGCATTATATAGG + Intergenic
1007003210 6:38334739-38334761 ATCCATCCTTATAATAATAAGGG + Intronic
1007651769 6:43427072-43427094 ATGCAGCCCTAGAATAATAAGGG + Intergenic
1010817618 6:80377011-80377033 TAGTGTCCTTTGAATTATAAAGG + Intergenic
1012655567 6:101815439-101815461 TTGAATCCTTATAATTAGAATGG + Intronic
1016063752 6:139657402-139657424 TAGCTGCTTTAGAATTATAATGG - Intergenic
1017538509 6:155374683-155374705 ATGCATCCTTAGAAATATTGGGG + Intergenic
1017613721 6:156220927-156220949 TAGCATCTTTAAAATTATAAAGG + Intergenic
1018202790 6:161410818-161410840 TTGAATCCTCAGAATGATATGGG + Intronic
1021983232 7:26075052-26075074 TTGCAGTCTTAGAAAGATAATGG + Intergenic
1022309166 7:29179021-29179043 CTGCCTCCTTAGGATTATAGGGG + Intronic
1024306836 7:47936398-47936420 TCGCATAAGTAGAATTATAAAGG + Intronic
1026402762 7:70032340-70032362 TTGCATTTTTAGAATTTTAAAGG + Intronic
1027817371 7:82993142-82993164 TTGAATATATAGAATTATAAAGG - Intronic
1028465313 7:91144891-91144913 TTATATCCTTAGAATTAGATAGG + Intronic
1029435251 7:100560505-100560527 TTGCATCCTGTGGATTAGAAAGG + Intronic
1030958406 7:115884841-115884863 GTTCATCCTTCCAATTATAAAGG - Intergenic
1031826375 7:126571101-126571123 TTGCATACTTAGACTGAGAAGGG - Intronic
1031907883 7:127480825-127480847 TTGCAGTCTTAGTTTTATAAAGG - Intergenic
1033635053 7:143204559-143204581 TTTCATTCTAAGAATTATCATGG + Intergenic
1043461115 8:80461254-80461276 ATGAATCCTGAGCATTATAAAGG + Intergenic
1047763971 8:127975098-127975120 TGGCACCCTTAGAAGTGTAACGG - Intergenic
1050319352 9:4435253-4435275 TTTCATACTCAGAATTATAATGG + Intergenic
1051896203 9:21991717-21991739 TTGCTACCTTAGGATCATAATGG + Intronic
1051938635 9:22475802-22475824 TTGCAGTTTTAGATTTATAAAGG + Intergenic
1051995498 9:23211295-23211317 TTGTTTCCTTAGAATTAAAGTGG + Intergenic
1054984663 9:71247582-71247604 TTCCATCCTCAGAAATAGAAGGG + Intronic
1055685783 9:78772964-78772986 GTGCATGCTTAGAATTATTGGGG - Intergenic
1056084951 9:83138477-83138499 TTGCAAACAAAGAATTATAATGG + Intergenic
1056881602 9:90398889-90398911 TTGCATCCTTTCTATTATTAGGG - Intergenic
1057584328 9:96315821-96315843 TTAAATACATAGAATTATAACGG + Intergenic
1058658220 9:107244805-107244827 GTGCATGCTTAGACTTATGAGGG - Intergenic
1058854195 9:109044115-109044137 TTTCATCCTAGGATTTATAAAGG - Intronic
1059914327 9:119082156-119082178 TTGCATCTTCACACTTATAACGG + Intergenic
1185748928 X:2594797-2594819 CTGCATCCCCAGAATTTTAAGGG + Intergenic
1185844045 X:3420439-3420461 TTGCATTCGCAGAATTTTAAAGG + Intergenic
1187373076 X:18726401-18726423 TTCCTTCCTTTGAATAATAATGG - Intronic
1187800143 X:23052956-23052978 TTGCTTCCTTGGAATTATTATGG - Intergenic
1188911821 X:35858462-35858484 TTGCATCCTTACATCTTTAATGG + Intergenic
1192049989 X:67715920-67715942 TTGGATGCTTAAAGTTATAAAGG - Intronic
1192170487 X:68851571-68851593 TTGCCTGCTTATTATTATAAGGG + Intergenic
1192236463 X:69299386-69299408 TTTCATGCTTGGAATTCTAATGG - Intergenic
1194402203 X:93452374-93452396 TTGCATCTCTATAGTTATAATGG + Intergenic
1196715305 X:118805351-118805373 TTGCATCCTTACTATTATTGAGG - Intergenic
1199340364 X:146670333-146670355 TTGCACCCATAGACATATAAGGG + Intergenic
1201196750 Y:11501829-11501851 TTGCATCCATAGGAATAGAATGG + Intergenic
1202179855 Y:22130440-22130462 TTGCATCCTTAGGGATATTATGG + Intergenic
1202211506 Y:22455954-22455976 TTGCATCCTTAGGGATATTATGG - Intergenic