ID: 1064960491

View in Genome Browser
Species Human (GRCh38)
Location 10:20958565-20958587
Sequence ATTAATATTCAGATGGGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 238}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064960491_1064960495 6 Left 1064960491 10:20958565-20958587 CCAAACCCCATCTGAATATTAAT 0: 1
1: 0
2: 1
3: 19
4: 238
Right 1064960495 10:20958594-20958616 AATGAGATGAAGACATCTTCTGG No data
1064960491_1064960496 16 Left 1064960491 10:20958565-20958587 CCAAACCCCATCTGAATATTAAT 0: 1
1: 0
2: 1
3: 19
4: 238
Right 1064960496 10:20958604-20958626 AGACATCTTCTGGAATTTCATGG No data
1064960491_1064960498 18 Left 1064960491 10:20958565-20958587 CCAAACCCCATCTGAATATTAAT 0: 1
1: 0
2: 1
3: 19
4: 238
Right 1064960498 10:20958606-20958628 ACATCTTCTGGAATTTCATGGGG No data
1064960491_1064960497 17 Left 1064960491 10:20958565-20958587 CCAAACCCCATCTGAATATTAAT 0: 1
1: 0
2: 1
3: 19
4: 238
Right 1064960497 10:20958605-20958627 GACATCTTCTGGAATTTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064960491 Original CRISPR ATTAATATTCAGATGGGGTT TGG (reversed) Intronic
901342857 1:8511054-8511076 ATTAAAATAAAAATGGGGTTGGG - Intronic
902055423 1:13596631-13596653 ATCAATATTCAGACGAGGTCAGG + Intronic
902357833 1:15919392-15919414 TTTTATATTCAGCTGGGTTTTGG + Exonic
902959521 1:19953032-19953054 ATTAATTTTCAGCTTTGGTTTGG + Intergenic
906573780 1:46869118-46869140 TTTAAAATTCATATGGGGCTGGG + Intergenic
906598132 1:47098110-47098132 TTTAAAATTCATATGGGGCTGGG - Intronic
908265962 1:62379558-62379580 ATTTATTTTGAGATGGAGTTTGG - Intergenic
910675786 1:89815316-89815338 ATTAAGTTTAAGATGGGGGTGGG + Intronic
911804427 1:102187488-102187510 ACTGATATTCAGATGGAGATTGG - Intergenic
911866378 1:103028932-103028954 ATTAAAATTATGATGGAGTTGGG - Intronic
913262296 1:117010441-117010463 ATAAATATTTAGATGGTGTGTGG + Intronic
913672494 1:121110877-121110899 ATTAGTATTCAGATGGTATATGG + Intergenic
914024259 1:143898241-143898263 ATTAGTATTCAGATGGTATATGG + Intergenic
914662752 1:149806264-149806286 ATTAGTATTCAGATGGTATATGG + Intronic
915509862 1:156380909-156380931 ATTATTATTGAGATAGGGTCTGG + Intronic
916023023 1:160810746-160810768 AATAATATTTAGATGGATTTTGG - Intronic
916403259 1:164471520-164471542 ATTAATTTTCAGATGAGGCAGGG - Intergenic
916613649 1:166417667-166417689 ATTAGCATCCAGATTGGGTTGGG - Intergenic
917793587 1:178515575-178515597 ATTAATTTTGAGATGGGGGTGGG + Intronic
918037583 1:180890342-180890364 ACTAATTTTCATATGGGGTTAGG + Intergenic
922104467 1:222500917-222500939 CTTAATATTCAGGTGAGCTTGGG + Intergenic
923248212 1:232154345-232154367 ATTATTATTCAGGTGTGGTGAGG - Intergenic
923703351 1:236321010-236321032 ATTAATTTTCAGATGGGAAAAGG + Intergenic
924346644 1:243078436-243078458 CTTAATATTCAGGTGAGCTTGGG + Intergenic
1064199629 10:13273691-13273713 ATTAAAATTTAGAATGGGTTGGG + Intergenic
1064366980 10:14717162-14717184 ATTAATATTGAGATGCCTTTGGG + Intronic
1064435211 10:15305084-15305106 ATTATTATTCAGGTGTGGTGAGG - Intronic
1064960491 10:20958565-20958587 ATTAATATTCAGATGGGGTTTGG - Intronic
1065656897 10:27960910-27960932 ATGAATATTAAGCTGGGTTTTGG + Intronic
1066729707 10:38426413-38426435 CTTAATATTCAGGTGAGCTTGGG - Intergenic
1068952938 10:62795489-62795511 ATTAATAATCTAATAGGGTTTGG - Intergenic
1069186209 10:65426806-65426828 ATTATTATTGAGATGGAATTTGG + Intergenic
1069668134 10:70178190-70178212 ATTTATTTTGAGATGGGGTCTGG - Intergenic
1070060108 10:72973761-72973783 ATTTATTTTTAGATGGGGTTGGG - Intergenic
1074742103 10:116495324-116495346 TTTAAAATTCATATGGGGCTGGG - Intergenic
1077605707 11:3610120-3610142 TTTAATATACAGATAGGGTTAGG - Intergenic
1077717104 11:4592604-4592626 TTTCATATTCATATGGTGTTTGG - Intergenic
1081832249 11:46122991-46123013 ATTTGTATTCAGTTGAGGTTGGG - Intergenic
1082076628 11:47980497-47980519 ATGAATATTCAGAGGGGGAGGGG + Intergenic
1082724740 11:56721213-56721235 ATAAATATTCACAAGGGATTGGG - Intergenic
1083313874 11:61802301-61802323 TTTAATACTCAGAGGGGGTTGGG - Exonic
1083677646 11:64335513-64335535 ATTAAAATTCAGGAAGGGTTAGG + Intergenic
1084152189 11:67293512-67293534 ATTTATTTTGAGATGGGGTCTGG + Intronic
1086344024 11:85877100-85877122 TTCAAAATTCATATGGGGTTTGG + Intronic
1088293707 11:108268800-108268822 ATTAAAACTTAGATGGGTTTTGG + Intronic
1089308719 11:117543880-117543902 ATAGGTATTCACATGGGGTTGGG + Intronic
1090316028 11:125789304-125789326 AGAAATATTCAGATGGAGGTGGG - Intronic
1093550243 12:20401223-20401245 ATTAATATTCAGATGGCATGAGG - Intronic
1093652978 12:21665045-21665067 AGACATATGCAGATGGGGTTTGG - Intronic
1093915653 12:24799754-24799776 ATTTATTTAGAGATGGGGTTTGG - Intergenic
1098968720 12:76825036-76825058 ATTAGTATTTAGAGGGGATTTGG + Intronic
1099538549 12:83875837-83875859 ATTTATTTTGAGATGGAGTTTGG + Intergenic
1100867102 12:98868720-98868742 AGCAATAATCAGATGGGGTCAGG - Intronic
1101034241 12:100689276-100689298 CTTAATATTCAGGTGGTGATGGG - Intergenic
1101259281 12:103012704-103012726 CTTAATATTCAGCTGGGGCTGGG - Intergenic
1102622208 12:114205053-114205075 ATTTATATTCAGATATGATTGGG + Intergenic
1103204001 12:119114040-119114062 TTTAATAATCAGTTGGTGTTTGG + Intronic
1104674692 12:130704561-130704583 ATTATTATTGAGATGGAGTCTGG - Intronic
1108000636 13:45902669-45902691 CTTAATACTCAGATGGAGCTGGG - Intergenic
1108406372 13:50107046-50107068 ATACATATTTAGATGGAGTTTGG - Intronic
1108670859 13:52686773-52686795 AGAAATATCCAGATGGGGCTGGG + Intronic
1110235021 13:73208121-73208143 ATTAATATTTAGATAGAATTGGG + Intergenic
1110354276 13:74548775-74548797 ATTCATATTCACATGTGTTTTGG - Intergenic
1111015587 13:82376934-82376956 GTTAATATTCACATGGAATTAGG - Intergenic
1111706118 13:91751192-91751214 GTTATTATTAAGATGGGTTTTGG - Intronic
1115533978 14:34355253-34355275 ATTAATGTTGAGATGGAGCTAGG - Intronic
1117335125 14:54750731-54750753 ATGAATATCTATATGGGGTTGGG + Intronic
1120117094 14:80632936-80632958 ATTAAAAATAGGATGGGGTTTGG + Intronic
1122305396 14:100762959-100762981 GTAAATCTTCAGATGGGGTGAGG + Intergenic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1126697698 15:51340240-51340262 ATTCACATTCTGATGTGGTTTGG - Intergenic
1129045733 15:72732652-72732674 ATTATTATTCAGATATGGTATGG + Intronic
1131448639 15:92520416-92520438 ATTTATTTTCAGATGGAGTCTGG - Intergenic
1131839420 15:96419778-96419800 ATTTATCCTCAGATGGTGTTCGG + Intergenic
1133988826 16:10689247-10689269 ATTGATATCCAGATGCGGTAAGG - Exonic
1137487356 16:48902736-48902758 ATTAATATTTCCTTGGGGTTGGG - Intergenic
1139045448 16:63052933-63052955 ATTGATAGTGAGATTGGGTTAGG - Intergenic
1139335839 16:66230593-66230615 ATTAACTTCCAGGTGGGGTTAGG - Intergenic
1142546233 17:705439-705461 ATTAAAAATCAGCTGGGGCTGGG + Intronic
1142830074 17:2542207-2542229 ATTGAACTTCAGATGGGGCTGGG + Intergenic
1144819400 17:18061023-18061045 TTTAAAATTCAGATCGGGTGTGG - Intronic
1146434952 17:32835809-32835831 ATTAATATTCACTTGGTTTTAGG - Intronic
1152285234 17:79408700-79408722 ATTATTATTCAGATGCAATTTGG - Intronic
1155276357 18:24191375-24191397 ATTAATAGACAGATGGGAGTAGG - Intronic
1155965037 18:32027797-32027819 ATTAATATGCATATGGGCGTGGG + Intronic
1157866184 18:51187079-51187101 CTTAATATGCAGAAGGGGTGGGG - Intronic
1158652123 18:59297573-59297595 TTAAAAATCCAGATGGGGTTGGG - Intronic
1162672698 19:12270746-12270768 ATAAATATTGAGGTGGGGCTGGG - Intronic
1163494198 19:17635294-17635316 ATTAATAAACAGATGGGGTCAGG - Intronic
1164454301 19:28394424-28394446 ATTAGCATTCATATGGGCTTGGG - Intergenic
1165534426 19:36431468-36431490 ATTAACACACAGAGGGGGTTGGG + Intergenic
1165929567 19:39347913-39347935 ATTTATATTCTGATGGGGGGAGG + Intronic
1166633313 19:44427176-44427198 ATTAAAATTGAGATGAGATTTGG + Exonic
1167558645 19:50211684-50211706 CTTAAGATTGAGATGGGGCTGGG + Intronic
1167904047 19:52643752-52643774 AGGAATCTTCAGATGGGGGTGGG + Intronic
1168715744 19:58526218-58526240 ATTATTATTGAGATGCAGTTTGG + Intronic
926005232 2:9368339-9368361 ATAAATCATCAGATGGGGATGGG + Intronic
926211738 2:10876066-10876088 ATTTATTTTGAGATGGAGTTTGG + Intergenic
928288625 2:30016748-30016770 ATCAATAGTAACATGGGGTTTGG + Intergenic
930331499 2:49990852-49990874 ATTAATCTCCAGTTGGGGTTTGG + Intronic
930517690 2:52429242-52429264 GTTAATACTGAGATGGGGTAGGG + Intergenic
931639099 2:64365703-64365725 ATTACAATTCAGATGAGATTTGG + Intergenic
931880254 2:66561578-66561600 ATTAATATTTAGCTAGCGTTAGG - Intronic
932277392 2:70461778-70461800 ATTAGTTTTCTGATGTGGTTGGG + Intronic
934874681 2:97906303-97906325 ATTAGTATGCAGATTGGGTATGG - Intronic
938889871 2:135693455-135693477 ATTAATAGTCAGATGTTGTAGGG + Intronic
939499664 2:142967616-142967638 ATTCATATTTAAATGTGGTTTGG - Intronic
940471492 2:154105781-154105803 CTCAATATTCACATGGGGCTAGG - Intronic
940556727 2:155238097-155238119 TTTAATGTTCAGATTGAGTTGGG + Intergenic
946846479 2:223863154-223863176 ATTACAATTCAGATGAGATTTGG + Intronic
1168888491 20:1276926-1276948 ATTAGAAATCAGTTGGGGTTCGG + Intronic
1170559068 20:17540406-17540428 ATTAATATACATGAGGGGTTGGG - Intronic
1170828175 20:19814946-19814968 ATTAATATTTGGATAGGATTTGG - Intergenic
1172704788 20:36875174-36875196 ATTTAGTTTCAGATGGGGGTGGG - Intergenic
1173052517 20:39577399-39577421 ATTTATATTCATAGGGGGTAGGG - Intergenic
1173390512 20:42628065-42628087 GTTAATGTCCAGATGGGGTGGGG - Intronic
1175690077 20:61058678-61058700 ATGCATAGGCAGATGGGGTTGGG + Intergenic
1177578323 21:22986935-22986957 ATTAAGATACAGGTGGTGTTTGG - Intergenic
1179941312 21:44640196-44640218 AATAATATTCCCATGGGGATGGG - Intronic
1182376082 22:29849072-29849094 GTTTAAATTCAGAGGGGGTTGGG + Intergenic
950276978 3:11670133-11670155 AAGAATATTCAGATGCGGATGGG + Intronic
950359995 3:12443427-12443449 ATAAATATTGAGATGTGGCTGGG + Intergenic
950975834 3:17243733-17243755 ATTAATGTTTTGATTGGGTTTGG + Intronic
953005567 3:38975517-38975539 ATTAATATTTGGATTGGTTTTGG + Intergenic
953127859 3:40109245-40109267 ATTATTATTCAGAAGTGGTGAGG - Intronic
953880329 3:46688018-46688040 ATTAAGGTTCACCTGGGGTTGGG - Intronic
956098473 3:65742464-65742486 ATGAATGTTCATATGGGCTTTGG + Intronic
956184046 3:66545522-66545544 ATTAATAGTCACCTGGGGCTGGG - Intergenic
957304914 3:78444794-78444816 ACTTATATTCATTTGGGGTTTGG - Intergenic
959057511 3:101582858-101582880 ATTAATATTTGGACAGGGTTTGG + Intronic
960692044 3:120356860-120356882 ATTCATAGTCTGATGGGGTGAGG + Intergenic
964375711 3:156046894-156046916 TTTAAAATTCATATGGGGCTGGG - Intronic
964418416 3:156474244-156474266 ATTTACATTAAGATGGGGTTGGG + Intronic
964717034 3:159733338-159733360 ATGTATATACAGCTGGGGTTGGG + Intronic
964981039 3:162680020-162680042 ATTAATATTTAGATGATGTTCGG + Intergenic
966457173 3:180130493-180130515 ATTAATATTCTGATGGAGATTGG + Intergenic
969571553 4:8011898-8011920 ATGAATTATAAGATGGGGTTTGG - Intronic
969622396 4:8285226-8285248 ATTCACAGTCACATGGGGTTAGG + Intronic
971146670 4:23984369-23984391 ATTACTGATGAGATGGGGTTGGG - Intergenic
971590665 4:28464904-28464926 TTTAATTTGCAGATGTGGTTTGG - Intergenic
974620513 4:64347785-64347807 ATTATAATTGAGATGAGGTTTGG + Intronic
976304855 4:83549732-83549754 ATTATTATTGAGATGGAGTCTGG + Intronic
977684334 4:99830719-99830741 ATTAAAAGTCTGGTGGGGTTTGG - Intronic
977716107 4:100185609-100185631 ACTCATATTCAGATAGGGTTAGG + Intergenic
978765457 4:112400749-112400771 TTCAATATTCAGATGTGGGTTGG + Intronic
979256074 4:118609252-118609274 CTTAATATTCAGGTGAGCTTGGG - Intergenic
979332270 4:119431285-119431307 CTTAATATTCAGGTGAGCTTGGG + Intergenic
980203833 4:129691859-129691881 ATGAAAATTCAGATGAGATTTGG + Intergenic
982864917 4:160498868-160498890 ATCAGTATTAAAATGGGGTTTGG + Intergenic
983481129 4:168275447-168275469 ATAAATATTCAGTTGGCATTGGG - Exonic
984769333 4:183423869-183423891 ATTATTATTCAGGTAGGGTGAGG + Intergenic
985423123 4:189803927-189803949 ATGATTATTCAGATGTGGTGAGG + Intergenic
987253578 5:16125273-16125295 TTTAATATACAGATTGGCTTTGG - Intronic
988807839 5:34756812-34756834 AGAATTATTCAGTTGGGGTTTGG + Intronic
989362255 5:40615766-40615788 GTTTTTATTCAGTTGGGGTTTGG - Intergenic
990652279 5:57915189-57915211 ATTAATATTGAAATGGAATTAGG + Intergenic
990960884 5:61392622-61392644 ATTTATATTGAGATGGAGTTCGG + Intronic
991065923 5:62424730-62424752 ACAAATATTCAGATTGGGTGTGG - Intronic
994329462 5:98488612-98488634 ATTTTTATACAGATGGGGGTGGG + Intergenic
995955954 5:117776440-117776462 ATTAAGAAACAGATGGTGTTTGG - Intergenic
996427233 5:123327644-123327666 ATTATTATTCTGCTGGGTTTGGG + Intergenic
996468119 5:123826534-123826556 ACTAAAATTCAGATGAGATTTGG - Intergenic
998019175 5:138755051-138755073 ATAAATATCCAGATGGGGTCAGG - Intronic
999352410 5:150886717-150886739 ATTCTTATTCCTATGGGGTTAGG + Intronic
999928166 5:156402526-156402548 ATAATTATTCAGAAGGGGGTGGG + Intronic
1000394895 5:160763677-160763699 ATTTCTATTCTGATGGGTTTGGG - Intronic
1000633493 5:163617308-163617330 ATTAGTACTAAGATGGTGTTAGG + Intergenic
1001981957 5:176044008-176044030 ATTGATACTCAGATGGGGCCTGG + Intergenic
1002235509 5:177800049-177800071 ATTGATACTCAGATGGGGCCTGG - Intergenic
1002546941 5:179955021-179955043 ATTACTAATTAGATGTGGTTTGG + Intronic
1002585333 5:180242883-180242905 AATAATATTCAAATAAGGTTTGG + Intronic
1003339904 6:5209841-5209863 ATAAACATTAAGATGGGGCTTGG + Intronic
1006233550 6:32607045-32607067 ATGAAAATACAAATGGGGTTTGG + Intergenic
1006972003 6:38055285-38055307 ATTTATAGTCAGATGGGGTTTGG + Intronic
1008789540 6:55213709-55213731 TCTAATATTCTGATGGGGATGGG + Intronic
1009225330 6:61015785-61015807 TTTAATATTCAGAGGGGTATAGG - Intergenic
1009326524 6:62356436-62356458 ATTAATATTTAGGTGTTGTTTGG + Intergenic
1009362703 6:62835136-62835158 TTTAATATTCAGAGGGGGAGAGG + Intergenic
1009368998 6:62878441-62878463 TTTAATATTCAGAGGGGGAGAGG + Intergenic
1010020943 6:71159151-71159173 ATTAAAATGCAGATGAGGTCGGG - Intergenic
1012280852 6:97327077-97327099 ATTACAATTCAGATGAGATTTGG - Intergenic
1012658106 6:101851832-101851854 TTTTATATTCACATGGAGTTTGG + Intronic
1012685482 6:102242963-102242985 ATTACAATTCAGATGTGATTTGG - Intergenic
1017213516 6:151882776-151882798 ATTAATATCCAGATACGGTCTGG + Intronic
1017932813 6:158974358-158974380 ATTAACATTCAGATGGTTATGGG - Intronic
1018019174 6:159742443-159742465 ATTCCTATGCAGAAGGGGTTAGG - Intronic
1018341685 6:162857482-162857504 ATTCATATTCAAATGGGTTGGGG + Intronic
1019394366 7:809198-809220 ATTACAATTCAGATGAGATTTGG - Intergenic
1020336407 7:7065633-7065655 AGTAATATTCAGAGGGGGAGAGG + Intergenic
1023114501 7:36848598-36848620 ATTAATATGCAAATGAGGTCTGG + Intergenic
1023757015 7:43429097-43429119 ATCAATATTTAGTTGTGGTTTGG - Intronic
1023857574 7:44194094-44194116 ATTACAATTCAGATGAGATTTGG - Intronic
1024071779 7:45792382-45792404 CTTAATATTCAGGTGAGCTTGGG - Intergenic
1024227139 7:47334399-47334421 AGTGGTATTCAGAGGGGGTTTGG - Intronic
1028187250 7:87801465-87801487 ATTAATATTCCGATTGGGCGTGG + Intronic
1028437223 7:90817985-90818007 TTTAAGAGTCAGATGGGCTTAGG - Intronic
1030952873 7:115813807-115813829 ATTAATAGTTAGATTGGGTAAGG + Intergenic
1032048394 7:128629988-128630010 CTTAATATTCAGGTGAGCTTGGG - Intergenic
1032190016 7:129759507-129759529 ACTCATATTCAGAGGGGCTTGGG - Intergenic
1032291890 7:130596455-130596477 ATAAATATTCAGATGGATTTTGG + Intronic
1032557683 7:132854571-132854593 ATTAATTTTCAAAAGGGGGTTGG + Intronic
1033360160 7:140633339-140633361 ATTTTTATAGAGATGGGGTTTGG + Intronic
1034136906 7:148779363-148779385 ATTAGTGTTGGGATGGGGTTTGG + Intronic
1034158634 7:148976112-148976134 ATTTCTAATCAGATGGGGTGGGG + Intergenic
1036118763 8:5990851-5990873 ATTAATATTCACATGCCTTTAGG + Intergenic
1037677912 8:21067754-21067776 CTTAACAATCAGATGGAGTTTGG + Intergenic
1038929751 8:32179680-32179702 TTTAATATTCAGAAAGTGTTTGG + Intronic
1038933522 8:32221486-32221508 ATAAATAGTAAGATGGGGTAAGG + Intronic
1041225453 8:55692859-55692881 ATTACTATTCAGATGTGGTGAGG - Intergenic
1043043026 8:75286050-75286072 CTGAATATTCAGATGTGATTAGG + Intergenic
1043350314 8:79352763-79352785 ATTAATATTCCAATGGGGGAGGG + Intergenic
1044582540 8:93836425-93836447 ATTAGTATTCAAAGAGGGTTGGG + Intergenic
1044875866 8:96665886-96665908 ATTATTATTCAGATATGGTGAGG + Intronic
1045097734 8:98815973-98815995 ATATATATATAGATGGGGTTTGG - Intronic
1045633910 8:104160201-104160223 ATTTATAGTCTGATGGGATTTGG - Intronic
1045926817 8:107584975-107584997 TTTAATATTCAGGTGGGGAGAGG - Intergenic
1045927853 8:107591807-107591829 CTTAATATTCAGGTGGGGAGAGG + Intergenic
1046792668 8:118338861-118338883 ATTAACATTCATTTGGGTTTTGG - Intronic
1050230013 9:3513773-3513795 TTTAATATTTTGATTGGGTTAGG - Intronic
1050338494 9:4612809-4612831 ATTAATATTCAGGAGGGGGATGG + Intronic
1050573091 9:6962394-6962416 ATTAATGTTCAGATGAGTTAAGG + Intronic
1050761720 9:9080524-9080546 AATAATATACAAATAGGGTTAGG + Intronic
1051538211 9:18183968-18183990 ATTGTTTTTCAGATAGGGTTTGG + Intergenic
1051866864 9:21693596-21693618 TTTAACATTCAGATGGGAATTGG + Intergenic
1053559347 9:39174001-39174023 CTTAATATTCAGAACGTGTTAGG + Intronic
1053594427 9:39545538-39545560 ATTAATATGCACATGGAGATGGG + Intergenic
1053611783 9:39721221-39721243 ATTAACATGCATATGGGCTTGGG + Intergenic
1053823462 9:41994241-41994263 CTTAATATTCAGAACGTGTTAGG + Intronic
1053869821 9:42479223-42479245 ATTAACATGCATATGGGCTTGGG + Intergenic
1054086472 9:60749934-60749956 ATTAACATGCATATGGGCTTGGG - Intergenic
1054137764 9:61444945-61444967 CTTAATATTCAGAACGTGTTAGG - Intergenic
1054241738 9:62621172-62621194 ATTAACATGCATATGGGCTTGGG - Intergenic
1054555863 9:66655695-66655717 ATTAACATGCATATGGGCTTAGG - Intergenic
1054571830 9:66819429-66819451 ATTAATATGCACATGGAGATGGG - Intergenic
1054607111 9:67193124-67193146 CTTAATATTCAGAACGTGTTAGG - Intergenic
1055606620 9:77977262-77977284 AGTAGTACTGAGATGGGGTTAGG - Intronic
1057344307 9:94234743-94234765 ATTACTTTTCACATGGGGGTGGG - Intergenic
1057987123 9:99728547-99728569 ATTAAATTTCAGATTTGGTTTGG + Intergenic
1058442649 9:105024155-105024177 ATTAATATTCAGCCTGGGGTTGG + Intergenic
1058469248 9:105260213-105260235 ATTACTTTTCAAATGGGGTTGGG - Intronic
1058671727 9:107366083-107366105 TTTAAAATTCAAATGGGGCTGGG + Intergenic
1059083744 9:111277338-111277360 ATCTAAATTCAGATGGGTTTGGG + Intergenic
1059275762 9:113095769-113095791 ATGATTATTCATAAGGGGTTGGG - Intergenic
1186188756 X:7048059-7048081 ATAAATCCTCAGATGGAGTTTGG - Intergenic
1188642646 X:32525145-32525167 ATAAATATTAAGATTAGGTTAGG - Intronic
1188821333 X:34778973-34778995 ATTTAGATTCAGATGGGGATGGG + Intergenic
1189624483 X:42881566-42881588 ATTATAATTTACATGGGGTTTGG + Intergenic
1190061001 X:47211676-47211698 AAAAATATGCAGATGGGGTGGGG - Intronic
1192136947 X:68611627-68611649 TTTTATATTGTGATGGGGTTTGG + Intergenic
1194214152 X:91108205-91108227 ATTAATATTGAGATGTGGCCGGG + Intergenic
1194500083 X:94672028-94672050 ATTAGAATTTAGATGAGGTTTGG + Intergenic
1194664277 X:96660368-96660390 TTTAAAATTCATATGGGGCTGGG + Intergenic
1195798771 X:108683127-108683149 TTTCATATTCAAATGGTGTTGGG - Intronic
1197314141 X:124943105-124943127 ATTAATAGTCACCTGGGGTCTGG - Intronic
1197526437 X:127570214-127570236 ATTATTATTCAGATATGGTGAGG + Intergenic
1199063819 X:143390435-143390457 ATTAAAATCCAGATGGGGGCCGG + Intergenic
1199476861 X:148255337-148255359 ATTACAATTCAGATGAGATTTGG - Intergenic
1199659883 X:150038247-150038269 TTTATTATTCAGATGGTGTGAGG - Intergenic
1201324205 Y:12736884-12736906 ATTAATCTTCAAATGGAATTAGG - Intronic