ID: 1064964949

View in Genome Browser
Species Human (GRCh38)
Location 10:21005619-21005641
Sequence CGCTACTCGGGAGGCTCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064964941_1064964949 7 Left 1064964941 10:21005589-21005611 CCAGGCATGGTGGTGCACACTTG 0: 122
1: 2344
2: 8633
3: 34128
4: 84943
Right 1064964949 10:21005619-21005641 CGCTACTCGGGAGGCTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064964949 Original CRISPR CGCTACTCGGGAGGCTCAGG TGG Intronic
No off target data available for this crispr