ID: 1064968222

View in Genome Browser
Species Human (GRCh38)
Location 10:21036675-21036697
Sequence GCTTATATGGAGTAAAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064968222_1064968229 16 Left 1064968222 10:21036675-21036697 CCCTCCTTTTACTCCATATAAGC 0: 1
1: 0
2: 0
3: 9
4: 195
Right 1064968229 10:21036714-21036736 GCAGAAGAGGCATCTACCCCAGG No data
1064968222_1064968226 3 Left 1064968222 10:21036675-21036697 CCCTCCTTTTACTCCATATAAGC 0: 1
1: 0
2: 0
3: 9
4: 195
Right 1064968226 10:21036701-21036723 GCACGTTCCTCCAGCAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064968222 Original CRISPR GCTTATATGGAGTAAAAGGA GGG (reversed) Intronic
902069834 1:13724820-13724842 GCATAAAGGGAGAAAAAGGAAGG + Intronic
904446385 1:30576291-30576313 CCTTATCTAGAGAAAAAGGATGG - Intergenic
909972357 1:82005814-82005836 TCTTATCTTGGGTAAAAGGAGGG - Intergenic
912153806 1:106891022-106891044 GCTTATATTCAGAACAAGGAAGG + Intergenic
916292683 1:163184001-163184023 GCTCATTGGGAGGAAAAGGAAGG - Intronic
917935383 1:179861746-179861768 ACTTATCTGGCTTAAAAGGATGG - Intronic
918806811 1:189058768-189058790 GCTTTCATGGAGTAAATGAAAGG - Intergenic
921417748 1:214910385-214910407 GCTTACATAGAGTGAGAGGAAGG + Intergenic
923272668 1:232372118-232372140 GCTTTGATGAAGTGAAAGGAGGG - Intergenic
924109222 1:240681459-240681481 GCGTTTGTGGAGAAAAAGGAAGG + Intergenic
924948301 1:248860660-248860682 GATTATTTGGATTATAAGGATGG - Intergenic
1062839520 10:658551-658573 GCTTTTCTGGACTTAAAGGAGGG - Intronic
1063014973 10:2066951-2066973 CTTTATATTGAGTGAAAGGAAGG + Intergenic
1063545025 10:6972473-6972495 GCTTCTATGCAGTGAAAAGAAGG - Intergenic
1064884567 10:20096128-20096150 CCTTAGCTGGAATAAAAGGAGGG + Intronic
1064968222 10:21036675-21036697 GCTTATATGGAGTAAAAGGAGGG - Intronic
1068996660 10:63213601-63213623 GATTATATGAAGCAGAAGGATGG + Exonic
1069513730 10:69060987-69061009 GCTTATTTGTATTAAAAAGAGGG - Intergenic
1071303111 10:84272673-84272695 GCTTATAGGGATGTAAAGGAAGG + Intergenic
1075826557 10:125361876-125361898 GATTGAATGGATTAAAAGGATGG - Intergenic
1078143953 11:8710581-8710603 GGTTATCTGGAGTAAGGGGAGGG - Intronic
1078506237 11:11949546-11949568 ACTTTTATGGACTAAAATGAGGG - Intronic
1083209007 11:61171029-61171051 GATTCTATGGAGTAGGAGGAAGG - Intergenic
1085169651 11:74438480-74438502 GATTATGGGGAGTAAGAGGAAGG + Intergenic
1085361345 11:75890481-75890503 GCTTAGATGAAGTAACTGGATGG + Intronic
1086667502 11:89501403-89501425 GCTTATATTAAGTTAAGGGAAGG + Intergenic
1088084034 11:105956613-105956635 GTATATATGCAGTAACAGGATGG + Intronic
1088093691 11:106074370-106074392 GTTTTAATGGAGTAAAAGAAAGG - Intronic
1091893998 12:4085559-4085581 ACCCGTATGGAGTAAAAGGAAGG + Intergenic
1092875234 12:12842113-12842135 GCTTATTTGGGGTAAATAGAAGG - Intergenic
1095789540 12:46149261-46149283 GCTTTTATGGCTTAACAGGATGG - Intergenic
1097905833 12:64918938-64918960 GCTTTTATGGGCTATAAGGATGG - Intergenic
1097939132 12:65284676-65284698 TGTTAGCTGGAGTAAAAGGAAGG + Intronic
1098178287 12:67817241-67817263 GCTTATAATGAGTGAAAGGTAGG - Intergenic
1099904443 12:88755715-88755737 TCTGATAGGAAGTAAAAGGAAGG + Intergenic
1101213437 12:102557832-102557854 TCATATATGGAGCAAAAGGCTGG + Intergenic
1103017778 12:117508966-117508988 GCTTATATTGAATAGATGGATGG + Intronic
1103434605 12:120915151-120915173 GCTTTTGTGGAGAAAATGGAGGG - Intergenic
1106562898 13:30862124-30862146 GGAGATAGGGAGTAAAAGGATGG - Intergenic
1106681062 13:32008300-32008322 GAGAATATGGAGTTAAAGGAAGG + Intergenic
1107072138 13:36282042-36282064 GCTTATGAGTAGCAAAAGGATGG - Intronic
1109125982 13:58517464-58517486 GCTTATATGGAGGAAATCTAAGG + Intergenic
1109247642 13:59976076-59976098 GGTTATAAGGAGTAAAATGAGGG - Intronic
1110499557 13:76210886-76210908 GTTTAAATGGAGAAACAGGAAGG - Intergenic
1110991997 13:82053568-82053590 TTTTATATACAGTAAAAGGAAGG - Intergenic
1110996820 13:82120588-82120610 GCCTATTTGAAGTACAAGGAGGG + Intergenic
1111949164 13:94696561-94696583 GCATATAAGGAGGTAAAGGAAGG - Intergenic
1114814452 14:25940662-25940684 GGTTAAATGAAATAAAAGGATGG + Intergenic
1115221116 14:31059560-31059582 GCTGAAATGGAGTAAAAGAAAGG + Intronic
1115571238 14:34668499-34668521 GCCCATATGGAGAAGAAGGAAGG + Intergenic
1116434783 14:44884959-44884981 GAAAATATGGAGTAGAAGGATGG + Intergenic
1117934122 14:60882270-60882292 ACTGATAGGGAGTAGAAGGAAGG - Intronic
1118115083 14:62766646-62766668 AATTATAGGGAGTAGAAGGATGG + Intronic
1120173826 14:81273147-81273169 ACTTTGGTGGAGTAAAAGGAGGG - Intronic
1120470542 14:84918295-84918317 TCTTAGATGGAGTAAGAGGAAGG - Intergenic
1120726491 14:87947582-87947604 TCTCATATGCGGTAAAAGGAGGG - Intronic
1121214266 14:92235210-92235232 GCTAATCTGGAGGACAAGGAGGG - Intergenic
1123111556 14:105870375-105870397 GTTCATAAAGAGTAAAAGGATGG - Intergenic
1124480249 15:30073248-30073270 GATTATTTGGAGATAAAGGAGGG - Intergenic
1124817546 15:33010624-33010646 GATTATAAAGAGAAAAAGGAAGG + Intronic
1125091204 15:35795015-35795037 GATTAGATAAAGTAAAAGGATGG - Intergenic
1125174542 15:36805642-36805664 GGTTATCTGAAGTAACAGGAGGG - Intronic
1127342179 15:58058796-58058818 GCTGAACTGGAGTAAAAGAAAGG + Intronic
1127394001 15:58529039-58529061 GCTTACAAGGAATAGAAGGAGGG - Intronic
1128148509 15:65346425-65346447 GCGTCCATGGAGTAAAAGGGTGG + Intronic
1128162672 15:65434568-65434590 GCTTATCTGGAGACAAATGACGG - Intergenic
1129164368 15:73767969-73767991 GCTTCTATGGAGGAACCGGAGGG - Intergenic
1138779475 16:59765470-59765492 CTTTATATGGTCTAAAAGGAAGG - Intergenic
1141832433 16:86517200-86517222 GCTTCTAAGGAGTAAAGGGGTGG + Intergenic
1144618154 17:16795932-16795954 CCTTATATAGAGTAAAATAAGGG + Intronic
1144894550 17:18519763-18519785 CCTTATATAGAGTAAAATAAGGG - Intergenic
1145137676 17:20424481-20424503 CCTTATATAGAGTAAAATAAGGG + Intergenic
1149498623 17:57134875-57134897 GCTTAGAGGGAATATAAGGAAGG - Intergenic
1149871461 17:60185740-60185762 CCTTATATAGAGTAAAATAAGGG - Intronic
1153157610 18:2167187-2167209 CCTTATAGGAAGTAAAGGGATGG - Intergenic
1155191162 18:23432116-23432138 TCTTATATGGAGAAAAGGAAAGG + Intronic
1160176049 18:76595298-76595320 GGATATATAGAGTAGAAGGACGG + Intergenic
1166575247 19:43831010-43831032 GTTTATAAAGAGTCAAAGGAAGG + Intronic
926668673 2:15553473-15553495 GCTTTTATGGAGAAGAAAGAGGG + Exonic
928294036 2:30067053-30067075 GGAGATAGGGAGTAAAAGGATGG + Intergenic
928673270 2:33624438-33624460 GCTTTTAGGCAGTAAAAGGGAGG - Intergenic
930710287 2:54544364-54544386 GCTAATATGGAGTAATTGTAGGG - Intronic
933781232 2:85802826-85802848 GGTTATATGAAGTAAACAGAAGG + Intergenic
939075065 2:137590113-137590135 TCTGTTCTGGAGTAAAAGGAAGG - Intronic
939621518 2:144425095-144425117 GCTTATTTGGAGCAAATGAAGGG + Intronic
939676744 2:145081947-145081969 GCTGACATGGATTAAAAGCAAGG - Intergenic
942373297 2:175309613-175309635 GGATTTATGGAGTAAAAGGTAGG + Intergenic
942627661 2:177919969-177919991 GCTCATATGTAAGAAAAGGATGG + Intronic
943278512 2:185899830-185899852 TTTTATATGGAAAAAAAGGAAGG - Intergenic
943548494 2:189310891-189310913 ACAGATAGGGAGTAAAAGGATGG + Intergenic
945687440 2:212988830-212988852 TCTTATATGGAGGAAAACAATGG - Intergenic
945854838 2:215056932-215056954 GCTTGTGTGAAGTAACAGGAAGG - Intronic
1169410945 20:5369884-5369906 GCTTATCTGCAGTGACAGGAGGG - Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1170608551 20:17893185-17893207 GGTGATAGAGAGTAAAAGGATGG + Intergenic
1172925616 20:38531896-38531918 GTTTATATGGGGAAAAATGAGGG + Intronic
1173129764 20:40380067-40380089 GCTTATCTCTAGGAAAAGGAAGG - Intergenic
1173920528 20:46741447-46741469 GATTGGATGGAGAAAAAGGATGG - Intergenic
1176005201 20:62858482-62858504 TTTTATAGGGAGGAAAAGGAAGG + Intronic
1176444159 21:6803841-6803863 GGACATATGGAGTATAAGGATGG - Intergenic
1176822325 21:13668879-13668901 GGACATATGGAGTATAAGGATGG - Intergenic
1177686056 21:24438792-24438814 GCTTATAAGGAGTGTAAGAAAGG + Intergenic
1177689794 21:24490825-24490847 GCATATATGGAATAAAACAATGG + Intergenic
1181946017 22:26518356-26518378 GCGTATAAGGAGTATATGGAGGG + Intergenic
950689947 3:14647605-14647627 GCAAATCTGGAGTAACAGGATGG - Intergenic
951073770 3:18364651-18364673 GTTTATGTGGGGTAAGAGGAAGG - Intronic
951814205 3:26735483-26735505 GCAAATATGGAGTAGAGGGAAGG - Intergenic
952495695 3:33913950-33913972 GCAGATATGGAGGAAAGGGAGGG + Intergenic
953138621 3:40206114-40206136 GCTGATATGGAGTCCATGGATGG - Intronic
954058391 3:48047556-48047578 ACTTATAAGGAGTCAAAAGACGG + Intronic
955552275 3:60097268-60097290 GCTTAAATGGAATAGTAGGAAGG + Intronic
955664306 3:61334000-61334022 CCTTAAATGGAATAAAAAGATGG - Intergenic
955837448 3:63072107-63072129 GCTTATCTGGGTTAGAAGGAAGG + Intergenic
956634656 3:71351793-71351815 GCTAATATGAAGTAAAATGAGGG + Intronic
956758276 3:72412230-72412252 GCTAATATGGAAAATAAGGACGG - Intronic
959449827 3:106485442-106485464 GCTTTTAATGAGAAAAAGGAAGG - Intergenic
959812053 3:110630781-110630803 ACCAATATGGAGTAACAGGATGG - Intergenic
960214927 3:115020999-115021021 TGTTAGATGGAGTAAAAGGCAGG + Intronic
966053581 3:175653191-175653213 GCCTATATGGAGGAGATGGAAGG + Intronic
966525592 3:180915655-180915677 GCCTATACGGGGTAAGAGGAGGG - Intronic
970513085 4:16800374-16800396 GTTTATATGCACTAAAAGAATGG - Intronic
970897941 4:21125047-21125069 GCTTCTCTGGAGCAAAAGGTAGG - Intronic
970980669 4:22093227-22093249 TCATATATGGAGTGAAAGGATGG + Intergenic
971092306 4:23360346-23360368 GTTTTTATGGCCTAAAAGGAAGG + Intergenic
971428938 4:26543420-26543442 TTTTATATGAAGTAAAAGCATGG + Intergenic
971825900 4:31622120-31622142 GCTTATAAATAGTAAAAAGAAGG - Intergenic
971838027 4:31794518-31794540 GCACATATAGAGTAAAAGGATGG - Intergenic
972985800 4:44763124-44763146 GATGATCTGGAGTACAAGGAAGG + Intergenic
973811930 4:54579877-54579899 GGGTATATGGAGTGAAAGGGTGG + Intergenic
974298766 4:60038121-60038143 GCATATTTGGAGTAAAATCAAGG + Intergenic
976365083 4:84224137-84224159 GCTTATAAGGAGAGAAAGTAGGG - Intergenic
978032955 4:103958476-103958498 GGTTGTACGGAGTAGAAGGATGG + Intergenic
978526568 4:109673275-109673297 GGTCATATGGAGTAATGGGATGG - Intronic
980726727 4:136770974-136770996 TTTTGTATGTAGTAAAAGGAAGG + Intergenic
981930045 4:150179987-150180009 ACTTTTATGGAGTAAATGAATGG - Intronic
982337112 4:154252510-154252532 GCAGATAGGGAGTAGAAGGATGG - Intronic
982766001 4:159349224-159349246 GCTTACATGAAGTGAAATGAAGG + Intronic
983070944 4:163266910-163266932 GCAGATATTGACTAAAAGGAAGG + Intergenic
983237251 4:165193401-165193423 TATTATATGGAGCAAAAAGATGG + Intronic
983676547 4:170301144-170301166 GGATATAGAGAGTAAAAGGATGG + Intergenic
984080431 4:175242433-175242455 GCTTATCTGGAATAAAATCAAGG - Intergenic
984168288 4:176330085-176330107 ACTTGTGTGGTGTAAAAGGATGG - Exonic
984967105 4:185149179-185149201 GCTGATAGGGAATAAAAGCAGGG + Exonic
991090398 5:62688805-62688827 TCTTATATTGAATGAAAGGAAGG - Intergenic
993970804 5:94417967-94417989 GCTGTTATGGAGCCAAAGGAGGG - Intronic
994035280 5:95192844-95192866 GCTGATATGGAAAAATAGGAAGG - Intronic
994733266 5:103520056-103520078 ACTTATGTGGAGAAAAAGGTGGG + Intergenic
995098469 5:108269187-108269209 GCTTTTAAGGAGTAGGAGGAAGG + Intronic
995545878 5:113230017-113230039 GCTAATGTGTAGTCAAAGGATGG + Intronic
996123235 5:119694835-119694857 GCTTAAATGGAATAAAAATAAGG - Intergenic
996376356 5:122812213-122812235 GCTTTTATTGAGTAAAATGGGGG - Intronic
998430295 5:142064540-142064562 GCTTCTGGGGAGTAAAAGGCAGG + Intergenic
1000381961 5:160637244-160637266 GAGTATATGGAGTATATGGATGG - Intronic
1008663550 6:53694181-53694203 GCGCATATGGAGAAAAAGAATGG - Intergenic
1008850758 6:56018234-56018256 ACTCCTATGAAGTAAAAGGAGGG + Intergenic
1011106884 6:83791989-83792011 GCTAATGTGTAGGAAAAGGAAGG + Intergenic
1011456222 6:87552726-87552748 GCTTAGCTGGAGTAAAAAGATGG + Intronic
1013055886 6:106582581-106582603 GATTATATGGACTTATAGGATGG - Intronic
1014012768 6:116495191-116495213 GGAGATATGGAGTAAAATGATGG - Intronic
1014073363 6:117208522-117208544 GGTTATAAAGAGTAGAAGGATGG - Intergenic
1015367577 6:132414336-132414358 ACTTAGATGGACAAAAAGGAAGG - Intergenic
1015755388 6:136600903-136600925 GCTTACATGGGGGGAAAGGAGGG - Intronic
1016371118 6:143375386-143375408 GGTCACATGGAGCAAAAGGAAGG - Intergenic
1020909221 7:14107730-14107752 GTTTATATGGAGAAGAAGCAAGG + Intergenic
1021099903 7:16575706-16575728 TCTCACATGAAGTAAAAGGAAGG - Intronic
1021346200 7:19531866-19531888 TTTTATATGTAGTGAAAGGAAGG + Intergenic
1021823124 7:24517951-24517973 GCTACTATAGAGTAAAAGCAGGG + Intergenic
1021896302 7:25239424-25239446 GCTAGTATGGAGTTAGAGGAGGG - Intergenic
1022092517 7:27117004-27117026 GCTTATAAGGAGTCAGAGGTCGG - Intronic
1022145628 7:27536882-27536904 GATTATATAAAGTAAAAGGCTGG - Intronic
1022169626 7:27812725-27812747 AATTCTATGGAGGAAAAGGATGG - Intronic
1022225127 7:28354908-28354930 GCCTGCATGGAGCAAAAGGATGG + Intronic
1022331673 7:29385213-29385235 AGTAAAATGGAGTAAAAGGAAGG - Intronic
1022381216 7:29861735-29861757 GCTTATGTGGTGAAAAATGAAGG + Intronic
1025970768 7:66322801-66322823 GCTGCTATGGAGTAACAGTACGG - Intronic
1028307711 7:89286978-89287000 GCTGAGAAGGAGGAAAAGGAGGG - Intronic
1031262326 7:119536608-119536630 GTATATATGGTGTAAAAGCAAGG - Intergenic
1034048056 7:147950755-147950777 GCTTTTAGGAAGAAAAAGGAAGG - Intronic
1035402404 7:158576098-158576120 GCTTATTTGGGGTAAGAGGCAGG - Intronic
1036383996 8:8261838-8261860 TTTTATAGGAAGTAAAAGGAAGG + Intergenic
1036936296 8:13005253-13005275 GGTTATAGAGAGTAGAAGGATGG + Intronic
1039227651 8:35405949-35405971 ACTTAAATGGACTAAAGGGAAGG + Intronic
1039339316 8:36629450-36629472 GCTTATCTGGAGTCACATGATGG - Intergenic
1040617857 8:49057312-49057334 GCTTATTAGGAGGAAAAGAAAGG - Intronic
1043007229 8:74834636-74834658 GCATATGTGGAGTAAAAGGCAGG - Intronic
1043621761 8:82202010-82202032 ATTTATATGGGGTATAAGGAAGG - Intergenic
1044252895 8:90024892-90024914 TTGTATAAGGAGTAAAAGGAAGG + Intronic
1044461851 8:92454736-92454758 GATTATATGGAGAATAAGTAAGG + Intergenic
1045446731 8:102273859-102273881 GCTTATATGTTTTAAAAGGGAGG + Intronic
1057068391 9:92075421-92075443 CCTTTTTTAGAGTAAAAGGAGGG - Intronic
1059397516 9:114047506-114047528 GCTGATATGGAGGGAAGGGAGGG - Intronic
1060639632 9:125227727-125227749 GCCTATAGGATGTAAAAGGAGGG + Intronic
1203525040 Un_GL000213v1:80686-80708 GGACATATGGAGTATAAGGATGG + Intergenic
1185551923 X:988826-988848 CCTTATATGAATTAAAAGGGAGG - Intergenic
1187058129 X:15760240-15760262 GCTTAAATAGAGGAAAAGGAAGG + Intronic
1187593766 X:20747659-20747681 TCTCATATGGAGCAATAGGAAGG + Intergenic
1188077727 X:25799195-25799217 GGATATACAGAGTAAAAGGATGG - Intergenic
1189716727 X:43874627-43874649 GCTTGTCTAGAATAAAAGGAAGG - Intronic
1195179948 X:102348373-102348395 TTCTATATGGGGTAAAAGGAGGG + Intergenic
1195645999 X:107231285-107231307 GGACATAGGGAGTAAAAGGATGG + Intronic
1196293386 X:113970083-113970105 GCTTATAAGAAGTAAAGAGATGG - Intergenic
1196855132 X:119975536-119975558 GCCCATATGGAGAAGAAGGAAGG + Intergenic
1197755000 X:129987199-129987221 GAATATATGGGGTAAAAGTAGGG + Intronic
1199035557 X:143045936-143045958 GCACATATAGAGTAGAAGGATGG - Intergenic
1200229023 X:154434854-154434876 CCTAAGAGGGAGTAAAAGGAGGG + Intronic