ID: 1064969328

View in Genome Browser
Species Human (GRCh38)
Location 10:21048341-21048363
Sequence ATGTAAATACAGATGCAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064969325_1064969328 10 Left 1064969325 10:21048308-21048330 CCACAGCATGCTGGGGAAACACG 0: 1
1: 0
2: 1
3: 13
4: 123
Right 1064969328 10:21048341-21048363 ATGTAAATACAGATGCAGTCTGG No data
1064969324_1064969328 11 Left 1064969324 10:21048307-21048329 CCCACAGCATGCTGGGGAAACAC 0: 1
1: 0
2: 2
3: 18
4: 194
Right 1064969328 10:21048341-21048363 ATGTAAATACAGATGCAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064969328 Original CRISPR ATGTAAATACAGATGCAGTC TGG Intronic
No off target data available for this crispr