ID: 1064973296

View in Genome Browser
Species Human (GRCh38)
Location 10:21088182-21088204
Sequence GGACACAGTGTACCACATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064973291_1064973296 8 Left 1064973291 10:21088151-21088173 CCACATTGTCAGTCTTCTGGCAG 0: 1
1: 0
2: 3
3: 15
4: 164
Right 1064973296 10:21088182-21088204 GGACACAGTGTACCACATCCTGG No data
1064973289_1064973296 22 Left 1064973289 10:21088137-21088159 CCAGTTGTTTCTCTCCACATTGT 0: 1
1: 0
2: 1
3: 25
4: 317
Right 1064973296 10:21088182-21088204 GGACACAGTGTACCACATCCTGG No data
1064973287_1064973296 30 Left 1064973287 10:21088129-21088151 CCTGGGGCCCAGTTGTTTCTCTC 0: 1
1: 0
2: 0
3: 15
4: 284
Right 1064973296 10:21088182-21088204 GGACACAGTGTACCACATCCTGG No data
1064973288_1064973296 23 Left 1064973288 10:21088136-21088158 CCCAGTTGTTTCTCTCCACATTG 0: 1
1: 0
2: 1
3: 20
4: 245
Right 1064973296 10:21088182-21088204 GGACACAGTGTACCACATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064973296 Original CRISPR GGACACAGTGTACCACATCC TGG Intronic
No off target data available for this crispr