ID: 1064976671

View in Genome Browser
Species Human (GRCh38)
Location 10:21124391-21124413
Sequence TATAATGGTTCAGCAAGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064976671_1064976678 9 Left 1064976671 10:21124391-21124413 CCTCCACTTGCTGAACCATTATA 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1064976678 10:21124423-21124445 GGGCCTTTTTTCCCTAGTAGAGG No data
1064976671_1064976682 30 Left 1064976671 10:21124391-21124413 CCTCCACTTGCTGAACCATTATA 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1064976682 10:21124444-21124466 GGTGATAAATGCTTACAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064976671 Original CRISPR TATAATGGTTCAGCAAGTGG AGG (reversed) Intronic
902625134 1:17671936-17671958 TGTAATGTTTCCCCAAGTGGGGG + Intronic
903449941 1:23446253-23446275 TATAAAGGTTAAGTAAGTGAAGG - Intronic
906700237 1:47852396-47852418 CATAGTGGGTCAGGAAGTGGGGG - Intronic
906794497 1:48686450-48686472 TATAATGGGTAAGCCAGAGGTGG - Intronic
907247785 1:53119198-53119220 CATTATGGTTCACCAACTGGAGG - Intronic
907495611 1:54842233-54842255 TATTAAAGTTCAGAAAGTGGTGG + Exonic
909857142 1:80549673-80549695 TAAAATGTTTCATCAAGTGTAGG - Intergenic
911216795 1:95203547-95203569 AATAATGGTTCAGCCAGGTGCGG - Intronic
911978973 1:104541873-104541895 TATAACTGGGCAGCAAGTGGTGG - Intergenic
912882361 1:113428488-113428510 TATAGTGGTTCAGAAAGAGTTGG - Intronic
915507484 1:156366953-156366975 TATAATGATTCAGCATCTGGAGG - Intronic
922042424 1:221909635-221909657 GGTAATGGTTAAGAAAGTGGAGG + Intergenic
1063644449 10:7865165-7865187 AATAGTGGTTCAGAAAGTAGGGG + Intronic
1064976671 10:21124391-21124413 TATAATGGTTCAGCAAGTGGAGG - Intronic
1066031176 10:31427249-31427271 TAGAATTCTTCAGTAAGTGGTGG - Intronic
1069839245 10:71328822-71328844 TGTCCTGGTTCAGCAAGTGGGGG + Intronic
1071712562 10:88063968-88063990 TATAAGAGCTCAGCAAGTGTAGG - Intergenic
1073871743 10:107872452-107872474 CATAATGGTTCAGTGACTGGAGG + Intergenic
1074142943 10:110691362-110691384 TAAAATGGTTCAGCCACTGTGGG - Intronic
1074262977 10:111872394-111872416 TACAATGGTAGAACAAGTGGTGG - Intergenic
1074495502 10:113976785-113976807 TAGAATTGGTCAGCTAGTGGTGG + Intergenic
1088784991 11:113173384-113173406 CCTAATGGTACAGAAAGTGGCGG + Intronic
1090024090 11:123152955-123152977 TAAAGTGGTTCAGCCACTGGCGG + Intronic
1106613824 13:31308683-31308705 TATAAAGGTTCCTCAAGAGGTGG + Intronic
1112757003 13:102647237-102647259 TATAATAGTTCACAAAGTAGTGG - Exonic
1113307942 13:109098389-109098411 GAAAATGCTTCTGCAAGTGGCGG - Intronic
1116921790 14:50585922-50585944 TATGATTGTTCAGAAAGTAGTGG + Intronic
1120040377 14:79746174-79746196 TATTATGTTTCAGCAAGTTTAGG - Intronic
1123050997 14:105542265-105542287 TTTAATGGAAGAGCAAGTGGTGG + Intergenic
1124193332 15:27599063-27599085 AATAATGTTTCAGCAAGTACTGG + Intergenic
1124800786 15:32830977-32830999 TAGAGTGGTTGAGTAAGTGGCGG - Intronic
1131122186 15:89829560-89829582 TAAAATGGTTGAGGAGGTGGTGG - Intergenic
1139059413 16:63230725-63230747 TACAATCCTTCAGCAAGTAGGGG + Intergenic
1140152595 16:72385639-72385661 TCTAATGGTTTAGGAAGTGCAGG + Intergenic
1144402240 17:14917351-14917373 TAAAATGGTTCGGCAACTGTGGG + Intergenic
1145399860 17:22522696-22522718 TATATGGGTTGAGCAAGAGGTGG - Intergenic
1146247671 17:31304264-31304286 TATAACAGTTCTGCAGGTGGAGG + Exonic
1149678972 17:58491086-58491108 AAGACTGGCTCAGCAAGTGGAGG - Exonic
1157088685 18:44609068-44609090 TATCTTGGTTCAGAAAGTGAAGG - Intergenic
1158415968 18:57250091-57250113 TATAACAGTTCAGCAAGGGAGGG + Intergenic
1158803666 18:60944162-60944184 TACAATGGTTTAGGAAGTGTTGG + Intergenic
1159198922 18:65157753-65157775 TGTAATTTTTCAGCTAGTGGAGG - Intergenic
926867456 2:17375491-17375513 AATGATGGCTCAGCAATTGGTGG + Intergenic
932639427 2:73428289-73428311 CATAATTATTCAGCAATTGGGGG + Intronic
934035548 2:88085960-88085982 TAAAATGGTTCAAAAAGAGGTGG + Intronic
935737061 2:106114738-106114760 TGTAATGGTTCAGCAACAGAGGG + Intronic
937936385 2:127249103-127249125 CATAATGGTGGAGCAGGTGGTGG - Intergenic
938197267 2:129339509-129339531 TATAATAGTTCAGTGAGGGGAGG + Intergenic
939693115 2:145290576-145290598 GATAATGGTTCAATAAGTGTTGG + Intergenic
940893112 2:159054476-159054498 TAACCTTGTTCAGCAAGTGGAGG + Intronic
944603815 2:201331277-201331299 GATAATGCTTCAGGAAGTGAAGG - Intronic
946003681 2:216504926-216504948 CATAATGGTTAAGAATGTGGAGG + Intronic
1169479440 20:5964911-5964933 TATAATGTAACAGCAAGTTGTGG - Intronic
1171244317 20:23598323-23598345 TCAAATGGTCCAGCTAGTGGTGG + Intergenic
1172925714 20:38532775-38532797 GGTATTAGTTCAGCAAGTGGTGG + Exonic
1173316967 20:41953669-41953691 TGTAAGGGCTCAGTAAGTGGTGG - Intergenic
1175757990 20:61541992-61542014 TTAAATGGTTCGGCATGTGGTGG - Intronic
1177944713 21:27453705-27453727 TATAATAGGTCAACAAGTGGTGG - Intergenic
1181769878 22:25117640-25117662 CACACTGCTTCAGCAAGTGGGGG + Intronic
1183638786 22:39080973-39080995 TCCACTGGTTCAGCAAGTGGAGG + Exonic
1184135634 22:42547956-42547978 TATCTTGGTTTAGGAAGTGGGGG + Intergenic
949120527 3:378654-378676 TTATTTGGTTCAGCAAGTGGAGG + Intronic
949755643 3:7407512-7407534 TAAAATGGTTCAGTAAATGCAGG - Intronic
954222685 3:49164181-49164203 TGTGGTGGTTCAGCATGTGGAGG - Exonic
956631480 3:71320812-71320834 TACAATGGTTCAGCAACACGCGG + Intronic
957027524 3:75199995-75200017 GATAATTGTTCAAAAAGTGGCGG - Intergenic
957425928 3:80038861-80038883 TATATTGGTTCAGTACATGGTGG + Intergenic
958146019 3:89625930-89625952 TATGATTATTCAGCAAGTGAAGG - Intergenic
963511062 3:146250509-146250531 TTTAATTGCTCAGCGAGTGGAGG - Intronic
963799780 3:149664177-149664199 CATACTGGTTCAGCAAGTCAGGG - Intronic
963964803 3:151354667-151354689 TAGAATGGTTAAGTAAATGGTGG + Intronic
966160052 3:176958098-176958120 TATTCTGGTTCAGTGAGTGGAGG + Intergenic
967148316 3:186625544-186625566 TCTGATGGTACAGCAAGTCGAGG + Intergenic
970257631 4:14185060-14185082 TATTATGGTTCAGGATTTGGGGG + Intergenic
971262655 4:25071075-25071097 TACAATGGGACAGCAGGTGGTGG - Intergenic
971294248 4:25375417-25375439 TATAATGGATCACCTGGTGGGGG - Intergenic
973529708 4:51823675-51823697 TAAAATGGTTCAGCCACTGTGGG - Intergenic
974432223 4:61814121-61814143 TATAGTGATTCAACTAGTGGAGG + Intronic
990219193 5:53568307-53568329 TATATTGGTTCAGTAAGTTTAGG + Intronic
994757553 5:103813520-103813542 TTTTAAGGTACAGCAAGTGGTGG - Intergenic
995663401 5:114511855-114511877 TCAAATGGTTCAGGAAATGGAGG + Intergenic
995924400 5:117353434-117353456 TAAAATGGTTCAGTAAATTGTGG - Intergenic
1001722011 5:173864625-173864647 CATAGTGGCCCAGCAAGTGGAGG - Intergenic
1021561256 7:21970792-21970814 TATAATGGTTCATCATGTAGAGG - Intergenic
1022448355 7:30489662-30489684 TAAAATGGTTCAGCCAATGTGGG + Intergenic
1027572717 7:79890968-79890990 TTAAATGGTTAAGCAAGTTGCGG + Intergenic
1030544547 7:110875867-110875889 TATAAGGCTTCATCAAGTTGTGG - Intronic
1031493965 7:122423629-122423651 TATTATGGTTCCACAAGTGTTGG + Intronic
1033031222 7:137829061-137829083 TAAAATAGTTCAGCTTGTGGTGG - Intronic
1033889156 7:145986985-145987007 TGTAATAATTCAGCAAGAGGAGG + Intergenic
1037022431 8:13989879-13989901 TAATATGGTTCAGCAAGTCTAGG + Intergenic
1037110302 8:15157778-15157800 TAGCATAGTTCAGCTAGTGGAGG - Intronic
1039252724 8:35684436-35684458 CATAATGGAGCAGCCAGTGGGGG + Intronic
1040921189 8:52619857-52619879 TAAAATGGTTCAGCCACTGTTGG + Intergenic
1042682523 8:71401807-71401829 AAAAATGATTCAGAAAGTGGTGG - Intergenic
1045437461 8:102178577-102178599 AATAATGGTACAGAAATTGGAGG - Intergenic
1056236666 9:84601322-84601344 TATAAGGGTGGAGCAAGGGGAGG + Intergenic
1056738725 9:89234377-89234399 GATAATGGTACAGCAATGGGCGG - Intergenic
1057400212 9:94716663-94716685 TATAGTGGTTCAGCCATGGGTGG - Intergenic
1185820078 X:3194434-3194456 TAAATTGGTTCAGCCACTGGTGG - Intergenic
1187375044 X:18744357-18744379 TATAATTGATCATCAAGAGGTGG - Intronic
1187777940 X:22784793-22784815 AATATTGGTTTAGCAGGTGGCGG - Intergenic
1189003686 X:36972572-36972594 TAGAAAGGTTCAGGAATTGGAGG - Intergenic
1189364211 X:40375706-40375728 TATCCAGGTGCAGCAAGTGGAGG + Intergenic
1193393560 X:80957644-80957666 TGAAATGGTCCATCAAGTGGTGG + Intergenic
1196428146 X:115592942-115592964 TATTTCGGTTCAGCAAGTGTTGG + Intronic
1197634205 X:128896473-128896495 TGTCATACTTCAGCAAGTGGAGG - Intergenic
1199493537 X:148427421-148427443 TATAAAGGTTCAGGAAGAGGAGG + Intergenic
1199571313 X:149269811-149269833 AATAAAGGTTGAGCCAGTGGTGG + Intergenic
1199645111 X:149901491-149901513 TATAAAGGTTTAGTAGGTGGAGG - Intergenic
1200246094 X:154526583-154526605 TATGATGGGGCAGCAAGTTGGGG + Intergenic