ID: 1064982107

View in Genome Browser
Species Human (GRCh38)
Location 10:21174651-21174673
Sequence CCCAAGGGCCGGGAGATCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064982093_1064982107 28 Left 1064982093 10:21174600-21174622 CCCAGCCCCAGGGCGGAGGCCGT No data
Right 1064982107 10:21174651-21174673 CCCAAGGGCCGGGAGATCCGCGG No data
1064982097_1064982107 21 Left 1064982097 10:21174607-21174629 CCAGGGCGGAGGCCGTCTCTGCT No data
Right 1064982107 10:21174651-21174673 CCCAAGGGCCGGGAGATCCGCGG No data
1064982095_1064982107 23 Left 1064982095 10:21174605-21174627 CCCCAGGGCGGAGGCCGTCTCTG No data
Right 1064982107 10:21174651-21174673 CCCAAGGGCCGGGAGATCCGCGG No data
1064982094_1064982107 27 Left 1064982094 10:21174601-21174623 CCAGCCCCAGGGCGGAGGCCGTC No data
Right 1064982107 10:21174651-21174673 CCCAAGGGCCGGGAGATCCGCGG No data
1064982098_1064982107 9 Left 1064982098 10:21174619-21174641 CCGTCTCTGCTGCGCGCAGCGAC No data
Right 1064982107 10:21174651-21174673 CCCAAGGGCCGGGAGATCCGCGG No data
1064982096_1064982107 22 Left 1064982096 10:21174606-21174628 CCCAGGGCGGAGGCCGTCTCTGC No data
Right 1064982107 10:21174651-21174673 CCCAAGGGCCGGGAGATCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064982107 Original CRISPR CCCAAGGGCCGGGAGATCCG CGG Intergenic
No off target data available for this crispr