ID: 1064987113

View in Genome Browser
Species Human (GRCh38)
Location 10:21221918-21221940
Sequence TCAACGCCATGCAGTCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064987113_1064987115 5 Left 1064987113 10:21221918-21221940 CCATCCTGACTGCATGGCGTTGA No data
Right 1064987115 10:21221946-21221968 GAAAGATGAGACCCCCTAGAAGG No data
1064987113_1064987116 8 Left 1064987113 10:21221918-21221940 CCATCCTGACTGCATGGCGTTGA No data
Right 1064987116 10:21221949-21221971 AGATGAGACCCCCTAGAAGGAGG No data
1064987113_1064987118 16 Left 1064987113 10:21221918-21221940 CCATCCTGACTGCATGGCGTTGA No data
Right 1064987118 10:21221957-21221979 CCCCCTAGAAGGAGGTAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064987113 Original CRISPR TCAACGCCATGCAGTCAGGA TGG (reversed) Intergenic