ID: 1064987630

View in Genome Browser
Species Human (GRCh38)
Location 10:21226675-21226697
Sequence AGGGAGAGTAAAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064987630_1064987636 25 Left 1064987630 10:21226675-21226697 CCCACAATCACTTTACTCTCCCT No data
Right 1064987636 10:21226723-21226745 TGTGTCACACAGCCATTACTGGG No data
1064987630_1064987635 24 Left 1064987630 10:21226675-21226697 CCCACAATCACTTTACTCTCCCT No data
Right 1064987635 10:21226722-21226744 CTGTGTCACACAGCCATTACTGG No data
1064987630_1064987637 26 Left 1064987630 10:21226675-21226697 CCCACAATCACTTTACTCTCCCT No data
Right 1064987637 10:21226724-21226746 GTGTCACACAGCCATTACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064987630 Original CRISPR AGGGAGAGTAAAGTGATTGT GGG (reversed) Intergenic
No off target data available for this crispr