ID: 1064991736

View in Genome Browser
Species Human (GRCh38)
Location 10:21262437-21262459
Sequence CACTCTTCAGAGACCCCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064991736_1064991740 19 Left 1064991736 10:21262437-21262459 CCTATGGGGGTCTCTGAAGAGTG No data
Right 1064991740 10:21262479-21262501 AGTGCCAGAGCTGGAAACCCAGG No data
1064991736_1064991737 10 Left 1064991736 10:21262437-21262459 CCTATGGGGGTCTCTGAAGAGTG No data
Right 1064991737 10:21262470-21262492 AAAGCTCCCAGTGCCAGAGCTGG No data
1064991736_1064991741 20 Left 1064991736 10:21262437-21262459 CCTATGGGGGTCTCTGAAGAGTG No data
Right 1064991741 10:21262480-21262502 GTGCCAGAGCTGGAAACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064991736 Original CRISPR CACTCTTCAGAGACCCCCAT AGG (reversed) Intergenic