ID: 1064991852

View in Genome Browser
Species Human (GRCh38)
Location 10:21263377-21263399
Sequence TTATGTTAGGGGAAAGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064991845_1064991852 5 Left 1064991845 10:21263349-21263371 CCTAAGCTAATAGAATTCTAGGC No data
Right 1064991852 10:21263377-21263399 TTATGTTAGGGGAAAGGGAAAGG No data
1064991842_1064991852 18 Left 1064991842 10:21263336-21263358 CCTAAAGAAACACCCTAAGCTAA No data
Right 1064991852 10:21263377-21263399 TTATGTTAGGGGAAAGGGAAAGG No data
1064991843_1064991852 6 Left 1064991843 10:21263348-21263370 CCCTAAGCTAATAGAATTCTAGG No data
Right 1064991852 10:21263377-21263399 TTATGTTAGGGGAAAGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064991852 Original CRISPR TTATGTTAGGGGAAAGGGAA AGG Intergenic
No off target data available for this crispr