ID: 1064993043

View in Genome Browser
Species Human (GRCh38)
Location 10:21273305-21273327
Sequence CTTGGAGACCAGCTCTCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064993043_1064993049 2 Left 1064993043 10:21273305-21273327 CCCTTGGAGAGCTGGTCTCCAAG No data
Right 1064993049 10:21273330-21273352 AAAGAGGGAATTGAGCTTCAGGG No data
1064993043_1064993048 1 Left 1064993043 10:21273305-21273327 CCCTTGGAGAGCTGGTCTCCAAG No data
Right 1064993048 10:21273329-21273351 GAAAGAGGGAATTGAGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064993043 Original CRISPR CTTGGAGACCAGCTCTCCAA GGG (reversed) Intergenic
No off target data available for this crispr