ID: 1064994189

View in Genome Browser
Species Human (GRCh38)
Location 10:21282033-21282055
Sequence CTATAGGAATGGGAAGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064994189_1064994197 24 Left 1064994189 10:21282033-21282055 CCAATTTCTTCCCATTCCTATAG No data
Right 1064994197 10:21282080-21282102 TGTGAGACTTTTGAAGGGAGAGG No data
1064994189_1064994195 18 Left 1064994189 10:21282033-21282055 CCAATTTCTTCCCATTCCTATAG No data
Right 1064994195 10:21282074-21282096 TGCGTATGTGAGACTTTTGAAGG No data
1064994189_1064994196 19 Left 1064994189 10:21282033-21282055 CCAATTTCTTCCCATTCCTATAG No data
Right 1064994196 10:21282075-21282097 GCGTATGTGAGACTTTTGAAGGG No data
1064994189_1064994193 -10 Left 1064994189 10:21282033-21282055 CCAATTTCTTCCCATTCCTATAG No data
Right 1064994193 10:21282046-21282068 ATTCCTATAGATGCAAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064994189 Original CRISPR CTATAGGAATGGGAAGAAAT TGG (reversed) Intergenic
No off target data available for this crispr