ID: 1064994674

View in Genome Browser
Species Human (GRCh38)
Location 10:21286079-21286101
Sequence AAAGAGCCAAGGTCATAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064994674_1064994676 -3 Left 1064994674 10:21286079-21286101 CCTCACTATGACCTTGGCTCTTT No data
Right 1064994676 10:21286099-21286121 TTTCTCAGCCTATCTGTGACTGG No data
1064994674_1064994678 9 Left 1064994674 10:21286079-21286101 CCTCACTATGACCTTGGCTCTTT No data
Right 1064994678 10:21286111-21286133 TCTGTGACTGGATGAATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064994674 Original CRISPR AAAGAGCCAAGGTCATAGTG AGG (reversed) Intergenic
No off target data available for this crispr