ID: 1064994787

View in Genome Browser
Species Human (GRCh38)
Location 10:21287078-21287100
Sequence GGTTGTGGATTTTCAGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064994787_1064994793 30 Left 1064994787 10:21287078-21287100 CCAGAAGCTGAAAATCCACAACC No data
Right 1064994793 10:21287131-21287153 CGGCATCCATCACAAAGACCAGG No data
1064994787_1064994791 10 Left 1064994787 10:21287078-21287100 CCAGAAGCTGAAAATCCACAACC No data
Right 1064994791 10:21287111-21287133 GTTAACAGAGAAGCAAGTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064994787 Original CRISPR GGTTGTGGATTTTCAGCTTC TGG (reversed) Intergenic
No off target data available for this crispr