ID: 1065001484

View in Genome Browser
Species Human (GRCh38)
Location 10:21341574-21341596
Sequence CCTATGAGGTCCTTTCTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065001481_1065001484 -3 Left 1065001481 10:21341554-21341576 CCTCAACACGACACTGCAAACCT No data
Right 1065001484 10:21341574-21341596 CCTATGAGGTCCTTTCTAACTGG No data
1065001480_1065001484 6 Left 1065001480 10:21341545-21341567 CCATGCTGACCTCAACACGACAC No data
Right 1065001484 10:21341574-21341596 CCTATGAGGTCCTTTCTAACTGG No data
1065001479_1065001484 26 Left 1065001479 10:21341525-21341547 CCTGGGAACAGAACTGTGGGCCA No data
Right 1065001484 10:21341574-21341596 CCTATGAGGTCCTTTCTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065001484 Original CRISPR CCTATGAGGTCCTTTCTAAC TGG Intergenic
No off target data available for this crispr