ID: 1065003719

View in Genome Browser
Species Human (GRCh38)
Location 10:21360960-21360982
Sequence CAGGAAAGAAGCAGATTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065003719_1065003721 -5 Left 1065003719 10:21360960-21360982 CCAAGAAATCTGCTTCTTTCCTG No data
Right 1065003721 10:21360978-21361000 TCCTGGTGTCATCTGTATATTGG No data
1065003719_1065003723 1 Left 1065003719 10:21360960-21360982 CCAAGAAATCTGCTTCTTTCCTG No data
Right 1065003723 10:21360984-21361006 TGTCATCTGTATATTGGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065003719 Original CRISPR CAGGAAAGAAGCAGATTTCT TGG (reversed) Intergenic
No off target data available for this crispr